ID: 1069347837

View in Genome Browser
Species Human (GRCh38)
Location 10:67490581-67490603
Sequence GTGGAGGGATGGTGGGAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069347818_1069347837 25 Left 1069347818 10:67490533-67490555 CCTTCTGGTGCAAGCCTACCTGG 0: 1
1: 0
2: 1
3: 8
4: 120
Right 1069347837 10:67490581-67490603 GTGGAGGGATGGTGGGAGATGGG No data
1069347825_1069347837 7 Left 1069347825 10:67490551-67490573 CCTGGGGAACAAGGGCAAGATGG 0: 1
1: 1
2: 2
3: 42
4: 524
Right 1069347837 10:67490581-67490603 GTGGAGGGATGGTGGGAGATGGG No data
1069347824_1069347837 11 Left 1069347824 10:67490547-67490569 CCTACCTGGGGAACAAGGGCAAG 0: 1
1: 2
2: 98
3: 1852
4: 16071
Right 1069347837 10:67490581-67490603 GTGGAGGGATGGTGGGAGATGGG No data
1069347817_1069347837 26 Left 1069347817 10:67490532-67490554 CCCTTCTGGTGCAAGCCTACCTG 0: 1
1: 0
2: 2
3: 7
4: 131
Right 1069347837 10:67490581-67490603 GTGGAGGGATGGTGGGAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069347837 Original CRISPR GTGGAGGGATGGTGGGAGAT GGG Intronic
No off target data available for this crispr