ID: 1069347949

View in Genome Browser
Species Human (GRCh38)
Location 10:67492079-67492101
Sequence AGTAAAATCATATACACCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 197}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069347949_1069347953 3 Left 1069347949 10:67492079-67492101 CCGTGGGTGTATATGATTTTACT 0: 1
1: 0
2: 1
3: 11
4: 197
Right 1069347953 10:67492105-67492127 TAGAGTATACAGAGGGTGTAGGG No data
1069347949_1069347952 2 Left 1069347949 10:67492079-67492101 CCGTGGGTGTATATGATTTTACT 0: 1
1: 0
2: 1
3: 11
4: 197
Right 1069347952 10:67492104-67492126 ATAGAGTATACAGAGGGTGTAGG No data
1069347949_1069347951 -4 Left 1069347949 10:67492079-67492101 CCGTGGGTGTATATGATTTTACT 0: 1
1: 0
2: 1
3: 11
4: 197
Right 1069347951 10:67492098-67492120 TACTCTATAGAGTATACAGAGGG No data
1069347949_1069347950 -5 Left 1069347949 10:67492079-67492101 CCGTGGGTGTATATGATTTTACT 0: 1
1: 0
2: 1
3: 11
4: 197
Right 1069347950 10:67492097-67492119 TTACTCTATAGAGTATACAGAGG No data
1069347949_1069347955 25 Left 1069347949 10:67492079-67492101 CCGTGGGTGTATATGATTTTACT 0: 1
1: 0
2: 1
3: 11
4: 197
Right 1069347955 10:67492127-67492149 GGAAAGAAAGAAAAATGAGAAGG No data
1069347949_1069347954 4 Left 1069347949 10:67492079-67492101 CCGTGGGTGTATATGATTTTACT 0: 1
1: 0
2: 1
3: 11
4: 197
Right 1069347954 10:67492106-67492128 AGAGTATACAGAGGGTGTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069347949 Original CRISPR AGTAAAATCATATACACCCA CGG (reversed) Intronic
903137036 1:21316240-21316262 ACTAGAATCAGATAAACCCACGG - Intronic
907505297 1:54913786-54913808 ACTAAAATCATAAATCCCCATGG - Intergenic
907700076 1:56777515-56777537 AGGGAAATGAGATACACCCAGGG + Intronic
908142633 1:61203162-61203184 AGTGAAACCATAGACACCAACGG - Intronic
909855541 1:80525339-80525361 AGGAAAATCATATTCACAAAGGG - Intergenic
910944129 1:92570216-92570238 AGTAAACTGATATACTTCCAAGG + Intronic
913938276 1:125077356-125077378 AGTAAAACCATAGTCATCCATGG + Intergenic
913944558 1:125146645-125146667 AGTAAAACCATAGTCATCCATGG - Intergenic
913954619 1:143277120-143277142 AGTAAAACCATAGTCATCCATGG + Intergenic
913982819 1:143538239-143538261 AGTAAAACCATAGTCATCCATGG - Intergenic
917787221 1:178471728-178471750 GGTAAAATCACATACCACCATGG - Intronic
918949478 1:191117457-191117479 ATTAAAATCATATTCACCACAGG - Intergenic
919104082 1:193127671-193127693 AGTTAAATCTTATGCAACCAAGG - Intronic
920504975 1:206508911-206508933 AGAAAAATAATAAACCCCCAAGG - Intronic
922512457 1:226180701-226180723 ATTAAAAACATATACACACTGGG + Intronic
1063990138 10:11552656-11552678 AGAAAATTCATACACACCAATGG + Intronic
1065943086 10:30582652-30582674 AATAAAATAATGTACACACATGG + Intergenic
1069347949 10:67492079-67492101 AGTAAAATCATATACACCCACGG - Intronic
1070642208 10:78178105-78178127 AGTAAGATGCTGTACACCCATGG - Intergenic
1070923364 10:80202952-80202974 AGGAGAATCATTTAAACCCAGGG + Intronic
1071420873 10:85497254-85497276 AGTAAATTGAAATACACGCAGGG - Intergenic
1071752927 10:88502118-88502140 ACTGAAATCAGAAACACCCAGGG + Intronic
1072820262 10:98549891-98549913 AGCAATATCATCTACTCCCACGG + Intronic
1075537324 10:123282381-123282403 TGTAAAATCATATACACAGAAGG - Intergenic
1076080590 10:127576884-127576906 AGTAAAATCATATTCCCAGATGG + Intergenic
1076321217 10:129583178-129583200 AGTTAAATAAAGTACACCCAAGG - Intronic
1078899295 11:15626611-15626633 ATTAAAAACATATACACTAATGG - Intergenic
1081073949 11:38645141-38645163 ATTAAAATCAAATAGACTCAAGG + Intergenic
1081562747 11:44233533-44233555 AATTAAACCATATACTCCCAGGG - Intronic
1082686993 11:56251387-56251409 AATAAAATAAAATACATCCAAGG + Intergenic
1082990416 11:59202490-59202512 AGTAAACAAATATAAACCCAAGG - Intronic
1083896253 11:65621236-65621258 AGTATCATCATTAACACCCATGG - Intronic
1084649612 11:70481353-70481375 AGTTAAATCAAACATACCCAAGG + Intronic
1086124604 11:83337338-83337360 TGTAAAACCACACACACCCAAGG - Intergenic
1087433774 11:98086757-98086779 ATTAAAATCATATACAGTTATGG - Intergenic
1091379428 12:46386-46408 AATAAAATAAAATAAACCCAAGG - Intergenic
1092396077 12:8128042-8128064 AGTGATATCATATATTCCCACGG - Intronic
1093461340 12:19409590-19409612 ACTAAAATCATTTCCCCCCACGG - Intronic
1095697431 12:45157408-45157430 AGTAATATCCTATTCCCCCATGG - Intergenic
1098072747 12:66693598-66693620 AGTAAAATCATATTCTCAGATGG - Intronic
1101595560 12:106161584-106161606 AGTAAAAGCAAATAAAACCAAGG - Intergenic
1101759681 12:107648490-107648512 AGCAAAGTCAGATACATCCACGG + Intronic
1103761501 12:123253682-123253704 AGGAAAATGAAATAAACCCACGG - Exonic
1104566747 12:129892055-129892077 AGAAAAATCAAATAAAGCCAAGG + Intronic
1105467431 13:20659017-20659039 AGAAAAAACATTTACACCCATGG + Intronic
1107209245 13:37832690-37832712 TTTAAAATTATAAACACCCAAGG + Intronic
1110277499 13:73656690-73656712 AGTAAAATGATTTACACGTAGGG + Intergenic
1110427268 13:75382502-75382524 ATTAAATTCATCTCCACCCATGG - Intronic
1112821163 13:103337779-103337801 AGTAAAATGATAAACACTCAAGG - Intergenic
1116770643 14:49123371-49123393 AGTTAAATTATAAACTCCCACGG - Intergenic
1122797169 14:104211885-104211907 AACAAAATCATAAAAACCCAAGG + Intergenic
1124219495 15:27837201-27837223 AATAAAATCATATCCTCCCTAGG + Intronic
1125843828 15:42832557-42832579 AGTAAAACCATGTATAACCATGG - Intronic
1127600966 15:60536605-60536627 ACTAAACTAATATAGACCCAAGG + Intronic
1129491861 15:75935026-75935048 AGTAAAATCATTTAGTCACATGG + Exonic
1129754248 15:78087020-78087042 AGGAAAATAATATACACACTTGG + Intronic
1130246898 15:82260283-82260305 AGTAAAATTATAAAAACTCATGG + Intronic
1130453751 15:84082742-84082764 AGTAAAATTATAAAAACTCATGG - Intergenic
1135839210 16:25859048-25859070 AATAAATTCATAAAAACCCAAGG - Intronic
1138616677 16:58173476-58173498 TGTAAAATGGAATACACCCATGG - Intronic
1139319790 16:66105132-66105154 AGCAAAATAATATACAGCCAGGG - Intergenic
1141246223 16:82310014-82310036 AGTAAAATTATATATAACCATGG - Intergenic
1141985883 16:87579533-87579555 AGTAGTATAATAAACACCCATGG - Intergenic
1143820563 17:9558222-9558244 AGTTAAAACATATTCAACCACGG + Intronic
1144063340 17:11602595-11602617 GGCAAAATCATACACACGCAAGG - Intronic
1144818446 17:18053519-18053541 AGGAGAATCACATAAACCCAGGG + Intronic
1149437009 17:56641622-56641644 AGCAAAATTATGTACACACATGG - Intergenic
1151081157 17:71330504-71330526 ATTAAAATAATATACACACTAGG + Intergenic
1151905789 17:77047859-77047881 AATAAAACCAAATTCACCCATGG - Intergenic
1203184227 17_KI270729v1_random:97218-97240 AGTAAAACCATAGTCATCCATGG - Intergenic
1153016592 18:587862-587884 AGTAGAATGATAGATACCCAAGG - Intergenic
1153210992 18:2764306-2764328 ATATAAATCATATACACACATGG - Intronic
1153446336 18:5176935-5176957 AGTTAAATTATATATACCCTTGG - Intronic
1153736340 18:8072745-8072767 AGTAGAATCCTATACAGCCCAGG + Intronic
1156159669 18:34344361-34344383 AGTAAATTCAGGTACAACCAAGG + Intergenic
1157186469 18:45544640-45544662 ACTAAAAGGATATACAACCAAGG - Intronic
1157199775 18:45650307-45650329 AAAAAAATCATAAACACACATGG - Intronic
1158630221 18:59107036-59107058 AGTAAACTCATGGAGACCCACGG + Intergenic
1167151824 19:47714387-47714409 AGTAAAATCATAAGCATCAACGG + Intronic
925127282 2:1468244-1468266 AGCAAAATCACAAAAACCCAAGG - Intronic
926813403 2:16776583-16776605 AGTAAAAACTTAGACAGCCATGG + Intergenic
927392611 2:22612178-22612200 ATTTAAATCACATACAACCAGGG - Intergenic
928568221 2:32575462-32575484 TTTAAAAGCATATACACCCTCGG + Intronic
928584454 2:32744748-32744770 ATTAAAAGCACATACATCCATGG + Intronic
928743363 2:34382534-34382556 AGCAAAACCATGTATACCCACGG + Intergenic
932505562 2:72227806-72227828 AGTAAAATTATAAACATCCTAGG - Intronic
936564338 2:113571541-113571563 AATAAAATAAAATAAACCCAAGG + Intergenic
937622575 2:124005818-124005840 AGTGAATTCTTATACTCCCATGG - Intergenic
938386061 2:130868223-130868245 AGTAAAAGCACATCCACCCTTGG - Intronic
940934899 2:159481451-159481473 AATAAAATAATATGCACCAAAGG + Intronic
941216223 2:162713014-162713036 AGGAGAATCATTTAAACCCAGGG - Intronic
941972265 2:171364144-171364166 TTTAAAATTATATACACACAGGG + Intronic
943859350 2:192840390-192840412 AGTAAAATTATCTAAACCTACGG - Intergenic
943862090 2:192879896-192879918 ATTTAGATCATGTACACCCAAGG + Intergenic
944851135 2:203720451-203720473 AGTAAAATCAAATATTCACAGGG + Intronic
945827152 2:214736003-214736025 ATGAAAGTCATATTCACCCAAGG + Intronic
947916835 2:233838235-233838257 AGTCAAATCATGAACACCCCAGG - Intronic
1169635089 20:7681269-7681291 AATAAAATGATTTACTCCCATGG - Intergenic
1169739351 20:8873750-8873772 AGTCAAATAATATAAACCAATGG - Intronic
1169926910 20:10793482-10793504 AGTAAATTCAAATACACAAAGGG - Intergenic
1172813232 20:37666199-37666221 AGGAAAATCATTTGAACCCAAGG - Intergenic
1173146826 20:40532043-40532065 TGTAAACACATATACACCTACGG + Intergenic
1174205942 20:48839127-48839149 ATTAAAGCCATATACATCCATGG - Intergenic
1174930875 20:54813057-54813079 AAAAACATGATATACACCCAAGG + Intergenic
1178818562 21:35954042-35954064 AGCAATATTATATCCACCCAGGG + Intronic
1178908911 21:36658677-36658699 AGTAAAATCACATGGGCCCAAGG - Intergenic
1179549224 21:42133115-42133137 AGCAAAATCATTTAGACACATGG + Intronic
1184623353 22:45700656-45700678 AGTAAACTGATATACAATCAAGG - Intronic
1184941999 22:47775412-47775434 AGTTAAATCATATGTACACAGGG + Intergenic
951104822 3:18730513-18730535 AGCAACATCATTTATACCCAGGG + Intergenic
951290849 3:20870779-20870801 AATAAATTCATATACCCCCGAGG + Intergenic
951838207 3:27005013-27005035 ACTAAAATCATAAATCCCCATGG + Intergenic
952250343 3:31647434-31647456 AATAAAAACAAATACACACAGGG + Intergenic
952448458 3:33407164-33407186 AACAAAATCAAATACAGCCAGGG + Intronic
955663309 3:61324352-61324374 AATTAAATCATAGACACCCTGGG - Intergenic
956755116 3:72378159-72378181 AGGAAAATCATATAAAACAATGG + Exonic
957284842 3:78204659-78204681 AGTAAAACCATTTACATGCATGG - Intergenic
957289366 3:78258557-78258579 AGAAATATCGTATACTCCCAAGG + Intergenic
957765297 3:84616944-84616966 AGTAAAATAAGATTCACCCACGG - Intergenic
960558298 3:119053810-119053832 AGTACAAGCATATAGACCAATGG + Intronic
961981977 3:131089232-131089254 AGTAAATCCACATAGACCCAAGG - Intronic
962953998 3:140247627-140247649 AGTATAAACAAACACACCCAAGG - Intronic
963823711 3:149928516-149928538 AGGATAATCATATAGACCAAAGG - Intronic
964060163 3:152512461-152512483 TGAAAAATCATATATACACAAGG - Intergenic
964127152 3:153246462-153246484 AGTGAAATAATATATACACATGG + Intergenic
964309686 3:155379494-155379516 ATAAAAATTATATACACTCAAGG + Intronic
965072544 3:163934000-163934022 AGAAAAATAATGTACATCCAAGG - Intergenic
965675651 3:171192920-171192942 AGAAAAAACACATACATCCATGG - Intronic
966625745 3:182014335-182014357 AGAAAAATTATATGAACCCAAGG + Intergenic
973308458 4:48678814-48678836 AGTAAAAACATATATACCATAGG + Intronic
974633579 4:64528754-64528776 AAAAAAGTCATATAGACCCATGG + Intergenic
975919469 4:79367295-79367317 AGTAGAATGCTATACCCCCAGGG - Intergenic
978037222 4:104010057-104010079 AATACACACATATACACCCAGGG + Intergenic
978528670 4:109692680-109692702 AGTAAACTCATCTAATCCCATGG + Intronic
980262831 4:130476139-130476161 AGTAAAATTATATATATTCATGG + Intergenic
981404717 4:144354814-144354836 ATTAACATCATATATAACCACGG + Intergenic
982573476 4:157078369-157078391 ATAAAAATTATATAAACCCATGG - Intronic
982764299 4:159326324-159326346 AGTAAAATGATAGAAACTCATGG - Intronic
983711779 4:170726136-170726158 AGCAAAATAATGTACACACATGG + Intergenic
983788902 4:171770192-171770214 AGTAAAAACATAGATATCCAAGG + Intergenic
984009860 4:174357586-174357608 AGTAAAATGTTATACAACTACGG + Intergenic
984610499 4:181831829-181831851 AGTAAATTCCTTTTCACCCATGG - Intergenic
987231417 5:15897581-15897603 AGTAAAAACATAAATTCCCAAGG + Intronic
988731188 5:33974495-33974517 AGCAAAATATTATTCACCCAAGG - Intronic
989500800 5:42165432-42165454 AATAAAATGATATACATCTATGG - Intergenic
989577100 5:42998745-42998767 GGTAGAATCATTTAAACCCAGGG + Intergenic
990617453 5:57522019-57522041 ACTAAAATCATAAATCCCCATGG - Intergenic
990987917 5:61658364-61658386 AGTTAAATAATAAGCACCCAAGG - Intronic
994884616 5:105543662-105543684 AGTTACATCTTACACACCCAAGG + Intergenic
996394354 5:122998213-122998235 AGTAAACACATACACACACATGG + Intronic
997014211 5:129912375-129912397 AGTCAACTCATGAACACCCAGGG + Intronic
999749649 5:154618020-154618042 TTTAAACTCACATACACCCAGGG + Intergenic
999856446 5:155599929-155599951 ATTAAAATCTGATACACTCAGGG - Intergenic
1000252804 5:159511230-159511252 AGTACCATGATATCCACCCAGGG - Intergenic
1003560297 6:7174329-7174351 ATTCAAATCATTTACACCCAAGG + Intronic
1006901480 6:37505117-37505139 AGAAAAATCAAATAAAGCCAGGG - Intergenic
1007201268 6:40111367-40111389 AGTTAAATAATATGTACCCATGG - Intergenic
1008064116 6:47029210-47029232 AGTGGAAACATAAACACCCAGGG - Intronic
1009768359 6:68111802-68111824 AGCAAACTCATATAAACCCGTGG + Intergenic
1011332018 6:86219043-86219065 ATAAAAATCATAAACACTCAAGG - Intergenic
1012438177 6:99236978-99237000 AGTAAAATCCTATTCATCCTAGG - Intergenic
1013008707 6:106100152-106100174 AGTAAAAGCACATAAACCTAAGG - Intronic
1014750781 6:125253484-125253506 AGTAAAATAATATGCAACCACGG + Intronic
1016150067 6:140729513-140729535 AGAAAAATCATATAAACATATGG + Intergenic
1018481061 6:164190773-164190795 AGAAAGACCATAGACACCCATGG + Intergenic
1018517949 6:164608473-164608495 AGTAAAATGATAGATACCAAAGG - Intergenic
1020336638 7:7067330-7067352 AGTAATATTATATCCACCCTTGG - Intergenic
1020337465 7:7073005-7073027 AGTAACATCATCTACCCCCTTGG - Intergenic
1020337732 7:7075410-7075432 AGTAACATCATCTACTCCCTTGG - Intergenic
1020854046 7:13394788-13394810 AGTAAATTAAAATACTCCCATGG + Intergenic
1021045989 7:15924048-15924070 AGGAAAAACATATAGACCAATGG + Intergenic
1021484282 7:21149720-21149742 AGTAAAATCACTTTCAGCCAAGG - Intergenic
1023368853 7:39491913-39491935 GCTAAAATAATATTCACCCAGGG + Intronic
1023719677 7:43079826-43079848 AGTAAAATGATAGACACCAAAGG + Intergenic
1025475100 7:60909583-60909605 AGTAAAACCATAGTCATCCATGG - Intergenic
1025487798 7:61073406-61073428 AGTAAAACCATAGTCATCCATGG + Intergenic
1025511900 7:61580311-61580333 AGTAAAACCATAGTCATCCATGG + Intergenic
1025566190 7:62437018-62437040 AGTAAAACCATAGTCATCCATGG - Intergenic
1025716081 7:63956861-63956883 AGAAAAATCATATGTCCCCAGGG + Intergenic
1026394012 7:69932985-69933007 AGTAAAATTATTTACATTCAAGG + Intronic
1028364930 7:90017683-90017705 AATAAAATAATTAACACCCATGG + Intergenic
1028588022 7:92470378-92470400 ACTAAAATCATAAATCCCCATGG - Exonic
1030471502 7:109969115-109969137 AGTAAAATCAGAAACAACAAGGG + Intergenic
1032122497 7:129167456-129167478 AGCAAAGTCATCTACACCAATGG + Exonic
1035391033 7:158505223-158505245 AATAAAATAATATAAACCCATGG + Intronic
1036127810 8:6079359-6079381 GGTAAAGAAATATACACCCACGG - Intergenic
1036511622 8:9405339-9405361 ATTAAAATCATATACAGGCTGGG - Intergenic
1037005404 8:13773220-13773242 AGTAAAAGCAAATAGACCAAAGG + Intergenic
1040420590 8:47236702-47236724 AGTAAAAGCACATAAACTCACGG + Intergenic
1043367369 8:79549281-79549303 TGTAAAATCATATACTCACTGGG - Intergenic
1046086475 8:109443156-109443178 AGAAATATCACATACACCCTGGG - Intronic
1046474981 8:114730428-114730450 ATTAACATTATATACAACCAAGG + Intergenic
1047320814 8:123780736-123780758 ACTAAAATAATAGAAACCCAAGG + Intronic
1047410700 8:124622222-124622244 AGTAAGATCACATACAAGCAAGG - Intronic
1047665076 8:127082731-127082753 AATAGGATCAAATACACCCAAGG + Intergenic
1049130968 8:140840364-140840386 AATAAAATCATATACATGTAGGG + Intronic
1049888088 9:41666-41688 AATAAAATAAAATAAACCCAAGG - Intergenic
1050396140 9:5198438-5198460 AGGACAATTATATAGACCCATGG - Intergenic
1051044115 9:12853074-12853096 AATAAAATAGTATACATCCATGG + Intergenic
1054717452 9:68570491-68570513 AAGAAAATCAAATACACACAAGG - Intergenic
1055198140 9:73622307-73622329 ATTAAAATCATTCACACACAAGG + Intergenic
1056372424 9:85970216-85970238 ATTAAAATTATTTTCACCCATGG - Intronic
1056556321 9:87692455-87692477 AGTTAATTCATATACATTCAAGG + Intronic
1058130256 9:101243878-101243900 AGGAATGTCATATACTCCCAGGG - Intronic
1194597139 X:95872410-95872432 AGAACAAACATATACACCAATGG + Intergenic
1196269599 X:113696131-113696153 AGTAAAATCATTTACAGACAAGG - Intergenic
1197038994 X:121911755-121911777 AGAAAAATCATATACAAAAAAGG - Intergenic
1197087956 X:122501571-122501593 ACTATAATCCTATACATCCATGG - Intergenic
1197240146 X:124114551-124114573 AGTAAAATCCTGTGCCCCCATGG - Intronic
1197381801 X:125752972-125752994 AGTAAACACATATACACCCAGGG + Intergenic