ID: 1069347953

View in Genome Browser
Species Human (GRCh38)
Location 10:67492105-67492127
Sequence TAGAGTATACAGAGGGTGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069347949_1069347953 3 Left 1069347949 10:67492079-67492101 CCGTGGGTGTATATGATTTTACT 0: 1
1: 0
2: 1
3: 11
4: 197
Right 1069347953 10:67492105-67492127 TAGAGTATACAGAGGGTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069347953 Original CRISPR TAGAGTATACAGAGGGTGTA GGG Intronic
No off target data available for this crispr