ID: 1069350604

View in Genome Browser
Species Human (GRCh38)
Location 10:67521759-67521781
Sequence GACCCACCTGCACCTCTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 151}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069350601_1069350604 16 Left 1069350601 10:67521720-67521742 CCTGTATCTGCTCTAACCATTAG 0: 1
1: 0
2: 0
3: 2
4: 98
Right 1069350604 10:67521759-67521781 GACCCACCTGCACCTCTGACAGG 0: 1
1: 0
2: 0
3: 15
4: 151
1069350602_1069350604 0 Left 1069350602 10:67521736-67521758 CCATTAGAAGATAAGTTTCCTCA 0: 1
1: 0
2: 0
3: 20
4: 287
Right 1069350604 10:67521759-67521781 GACCCACCTGCACCTCTGACAGG 0: 1
1: 0
2: 0
3: 15
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069350604 Original CRISPR GACCCACCTGCACCTCTGAC AGG Intronic
901136779 1:7002321-7002343 GACCCACCTGCATTACAGACTGG + Intronic
902173958 1:14635439-14635461 GACCTCCCTGCACCTCTCATAGG - Intronic
902671833 1:17980013-17980035 GAGCCACCTGCACAGCTGCCAGG + Intergenic
902814442 1:18908126-18908148 GTCCCACCTGCTCCTCTGATTGG - Exonic
903848029 1:26290046-26290068 GTCCCACCTGCAGCTCTCTCTGG + Intronic
904949086 1:34221722-34221744 GACCACCCTGCACATCTGTCAGG + Intergenic
905215315 1:36402241-36402263 GCCCCAGCTGCACCTCTGCCTGG + Intergenic
905475664 1:38225925-38225947 AGCCCAGCTCCACCTCTGACTGG - Intergenic
908053395 1:60257193-60257215 AGCCCACCTGCACCACTGAATGG + Intergenic
912472728 1:109916655-109916677 GACCCATATGCACCTCTGTTAGG + Intronic
920510178 1:206545078-206545100 GACCTACCTGCACATCTCTCAGG + Intronic
920736687 1:208539224-208539246 AAGCCACCTGCAGATCTGACAGG + Intergenic
923341566 1:233011946-233011968 GGGCCACCTGAACTTCTGACTGG - Intronic
1062790298 10:300041-300063 GACCCACGTGCACTGCTGGCGGG + Intronic
1062790955 10:306251-306273 GACCTGCCTGCATCTGTGACAGG - Intronic
1063248833 10:4252160-4252182 GACTCACCTGCACCTGAGCCAGG + Intergenic
1063407792 10:5813400-5813422 GACCGACCGCCACCTCAGACGGG + Exonic
1065101280 10:22335217-22335239 GGCCCACCCGCTCCTCTGCCCGG - Intergenic
1066435604 10:35394581-35394603 TGCCACCCTGCACCTCTGACCGG - Intronic
1069350604 10:67521759-67521781 GACCCACCTGCACCTCTGACAGG + Intronic
1070681457 10:78452039-78452061 GACCCAGCTCCATCTCTGAGTGG + Intergenic
1078848164 11:15140418-15140440 GGCCCACCAGCACCTCAGAGTGG - Intronic
1081712284 11:45225012-45225034 GACCCATCGGCAGCTCTGCCAGG + Exonic
1081984079 11:47289012-47289034 GACCCACCTTCACCACTCCCGGG - Exonic
1085272139 11:75276750-75276772 GAGCCACCTGGACCTGTAACAGG + Intronic
1085687667 11:78638892-78638914 CACCCACCTGGAACTCTCACTGG - Intergenic
1088541962 11:110921948-110921970 CTCCCACCTGGCCCTCTGACAGG + Intergenic
1089055984 11:115585317-115585339 GACCCACCTGAGCCTCAGGCAGG + Intergenic
1089742263 11:120592765-120592787 GCCCCTCCTGCAACTCTGAGGGG + Intronic
1093644869 12:21573783-21573805 GATCCACATGCAGCTCTGAGTGG - Intronic
1093996317 12:25646520-25646542 GACCCAGCTGCCCCTCTAAGGGG - Intronic
1098308388 12:69123847-69123869 GACCCTCCTGCACTTTAGACAGG + Intergenic
1100650880 12:96586904-96586926 AAGCCACCTTCACCTCTCACTGG - Intronic
1104842091 12:131830209-131830231 CACCCACCTGCCCCCCTGCCCGG + Intronic
1105205981 13:18224720-18224742 GTGCAGCCTGCACCTCTGACCGG + Intergenic
1105465207 13:20633481-20633503 GCACCTCCAGCACCTCTGACGGG + Intronic
1105505532 13:21006307-21006329 GACACACATGCAGCTCTAACAGG + Intronic
1106595261 13:31129983-31130005 GACCCAGCTGCACATCTGCCCGG - Intergenic
1108003703 13:45927156-45927178 GACCCAACTGCGCCTCTCCCAGG - Intergenic
1108756955 13:53514602-53514624 AACCCATATGCATCTCTGACTGG + Intergenic
1113586505 13:111469627-111469649 GACCTCACTGGACCTCTGACTGG - Intergenic
1113806541 13:113113428-113113450 GCCACAGCTCCACCTCTGACAGG - Intronic
1113969672 13:114179281-114179303 GCCCCAGCTGCTCCTCTGTCTGG + Intergenic
1119265062 14:73259530-73259552 CACCCACCTGCTCTGCTGACAGG - Exonic
1122985254 14:105208872-105208894 GGCCCACCTGCACCTCCCTCGGG + Intergenic
1123204485 14:106699137-106699159 GACCCACCTGCTCCGCTCTCTGG + Intergenic
1125476941 15:40054149-40054171 GACCAACCTGGACCTGTGACAGG + Intergenic
1125792887 15:42383078-42383100 GTCCCATCTGCAACTCTGAGTGG - Intronic
1126734716 15:51719171-51719193 GACCCACCTGAACATCTCACAGG + Intronic
1129592944 15:76933207-76933229 GACCCACTTGGAACGCTGACAGG - Intronic
1131969748 15:97879967-97879989 GGCCCACCTCCAACACTGACTGG + Intergenic
1132393836 15:101458027-101458049 GACCCAGCTCCACCTCTGGAGGG - Intronic
1132657835 16:1048718-1048740 GATCCTCCTGCCCCTCTGCCTGG + Intergenic
1132905495 16:2280597-2280619 AGCCCTCCTGCACCTCTGCCCGG - Intronic
1134055497 16:11167333-11167355 CAACTGCCTGCACCTCTGACTGG + Intronic
1135028418 16:19016555-19016577 GACCCACCTGGAGCTGTGGCGGG + Exonic
1135991156 16:27219504-27219526 AATCCATCTGCTCCTCTGACTGG - Intronic
1137564278 16:49523617-49523639 CACCCACCTGCAGCTCGGTCTGG + Exonic
1138376700 16:56569193-56569215 CACCCACATGTACCTGTGACAGG + Intergenic
1140041357 16:71410371-71410393 GGCCCAGGTGCAGCTCTGACAGG + Intergenic
1142186129 16:88695526-88695548 GAGCCACGTGGGCCTCTGACTGG - Intergenic
1144732600 17:17537280-17537302 GACCCACCTGCTCCTGGGCCTGG + Intronic
1146233006 17:31130573-31130595 GACCCACCCCCACCCCTTACCGG - Intronic
1146434705 17:32833646-32833668 GATCCACCCACAGCTCTGACCGG + Intronic
1147684234 17:42277052-42277074 GTCCCTCCCGCAGCTCTGACTGG - Intergenic
1149635488 17:58165433-58165455 GACCTACCTGTACTTTTGACAGG + Intergenic
1152761229 17:82108007-82108029 GACCCACCTGCTCCTGGGGCAGG + Intronic
1154314292 18:13292057-13292079 ACCCCAGCTGCACCTCTGAAGGG - Intronic
1157443029 18:47724633-47724655 GCCCCTCCTGCTCCTCTGGCTGG - Intergenic
1161235672 19:3196874-3196896 GACTCATCTGCACCCCTCACCGG - Intronic
1162054442 19:8054217-8054239 GACCCACCTGCCCCTCGGCTGGG + Intronic
1164130207 19:22354937-22354959 GCTGCTCCTGCACCTCTGACTGG - Intergenic
1164797514 19:31045948-31045970 CACCCACCTGTGCCTCTCACTGG + Intergenic
1165739606 19:38197530-38197552 GTCCCAGCTGCACCTGTGATTGG - Intronic
1167488988 19:49781146-49781168 GACATTCCTACACCTCTGACAGG - Intronic
1168465669 19:56599179-56599201 GTGCCACCAACACCTCTGACTGG - Intronic
925017973 2:546078-546100 AACCCACCAGCACCTGTGGCCGG - Intergenic
925779854 2:7372219-7372241 GACCCACCTGCACATTTGCGGGG - Intergenic
926066777 2:9846873-9846895 GACCAAACTGCACATCTGTCAGG - Intronic
927805849 2:26145819-26145841 GACTCACCTCCACCTCTCTCTGG - Intergenic
927869515 2:26614681-26614703 GACTCACATGCACCCCTCACAGG + Intronic
930108335 2:47657483-47657505 GACGCCCCTGCACCACTGAGCGG + Intergenic
931260339 2:60612546-60612568 AATCCACCTCCACTTCTGACTGG - Intergenic
931472822 2:62556490-62556512 ATCCCAGCTGCACCTCTTACTGG + Intergenic
931684926 2:64784812-64784834 GAACCACCTGAACCTCTGCCTGG + Intergenic
933507828 2:83201416-83201438 GACTAACCTGCCCCTCTGATAGG + Intergenic
936915246 2:117633460-117633482 GACCTACCTGCATCTATCACTGG - Intergenic
937094900 2:119229003-119229025 GACCCCCCAGCAGCTTTGACAGG + Intronic
939632061 2:144537307-144537329 GACCCCCCTCCACAGCTGACTGG - Intergenic
945072484 2:206005203-206005225 AACCCACCTACACCCCTGGCAGG - Exonic
948288666 2:236807929-236807951 GACCCACCTGGGCCTCTCAAAGG - Intergenic
948872932 2:240812692-240812714 GATCCACCTTCACCTCAGGCAGG + Intronic
1169190011 20:3652746-3652768 TGCTCACCTGCACCTCTTACTGG - Intergenic
1171360477 20:24583284-24583306 GGCCCACCTGCACTTTTGTCTGG + Intronic
1176134973 20:63518554-63518576 GACCCACATCCACCTCTTGCTGG - Intergenic
1179876919 21:44273285-44273307 CACCCACCAGCACCTCCGCCGGG + Intergenic
1180124354 21:45778895-45778917 GACCCACCTGCTCCAGTGGCAGG - Intronic
1181672452 22:24432095-24432117 CCCCCACCTGCTCCTCTGCCTGG - Intronic
1182417141 22:30228854-30228876 GAGCCACCAGCACCCCTGACAGG + Intergenic
1183140227 22:35930784-35930806 GACACACCTGCACTCCTGCCTGG + Intronic
1183317303 22:37143725-37143747 TACCCACCTCCTCCTCTGGCAGG - Intronic
1183652923 22:39169311-39169333 GACCCACCTCCACCTCTATGTGG + Intergenic
1183723046 22:39573387-39573409 GACCCAGCTGCGTCTCTGATGGG + Intronic
1184986544 22:48139968-48139990 TGCCAACCTGCACCTCTGAGAGG - Intergenic
1185088064 22:48751318-48751340 GCCCCGCCTGCGCCTCTGCCCGG - Intronic
1185275566 22:49948995-49949017 GGCCCACCTGCAACTCCCACTGG + Intergenic
950675232 3:14550558-14550580 GATCTACCTCCACCTCTGACTGG + Intergenic
955520611 3:59772109-59772131 CACCCACCTCCACCACTGAGGGG + Intronic
958938518 3:100284632-100284654 CAACCACCTGCACATCTGTCTGG - Intronic
964131819 3:153297171-153297193 CCCCCAACTCCACCTCTGACAGG - Intergenic
965994392 3:174862249-174862271 AACTCACCTGCACCACTGAGTGG + Intronic
966774031 3:183528438-183528460 GAGCCACTTGCACTTCTGGCAGG - Intronic
968933470 4:3597095-3597117 GACCCCCCAGCCCCTCTGCCTGG + Intergenic
969243387 4:5916614-5916636 AAACCACCTGCACCCCTGTCTGG - Intronic
969669677 4:8582759-8582781 GACCCTCCTCCACACCTGACGGG + Intronic
975908339 4:79242228-79242250 GGCCCACCTGCACCTTGGAGGGG + Intronic
979604304 4:122621253-122621275 GCCCCATCTGCATCTTTGACAGG + Intergenic
984878937 4:184393481-184393503 GCCCCTCCTGCACCTGCGACTGG - Intronic
985016272 4:185638822-185638844 GCTGCACCTGCACCTCTGCCGGG + Intronic
985347008 4:189016795-189016817 GACCTACATGCACATCAGACAGG + Intergenic
985391876 4:189498532-189498554 CACCCACCAGCACCCCTGGCTGG + Intergenic
986204652 5:5612163-5612185 GACTCTCTTGAACCTCTGACGGG - Intergenic
989205310 5:38804115-38804137 CCACCACCTGCACCCCTGACAGG - Intergenic
994944237 5:106364645-106364667 GATCCACATGCACCTTTGGCAGG - Intergenic
997720076 5:136071065-136071087 GACTCACCCGCCCCACTGACAGG - Intergenic
999149581 5:149417850-149417872 GTCCCAGCTGGACCTGTGACTGG + Intergenic
999595508 5:153199547-153199569 TACCCACTTCAACCTCTGACAGG - Intergenic
1002779818 6:357507-357529 GACCCAACTGAACCTCAGCCAGG - Intergenic
1003304840 6:4916888-4916910 GCCACACCTCCACCTCTGACAGG + Intronic
1007103608 6:39268468-39268490 GGGCCACCTGCACCTCTAACTGG - Intergenic
1007259961 6:40556427-40556449 GCCCCACCTGCACTTCTGAAAGG + Intronic
1007452919 6:41953781-41953803 GACCCACCTCCACATTTGATTGG - Intronic
1017865798 6:158442141-158442163 GACCCAACAGCACTTGTGACCGG - Intronic
1018794106 6:167172424-167172446 GAGCCACGTGCCCCTCTGAGAGG - Intronic
1018822229 6:167382652-167382674 GAACCACGTGCCCCTCTGAGAGG + Intronic
1019594880 7:1853856-1853878 GCCCCACCTGGCCGTCTGACAGG + Intronic
1020269972 7:6589225-6589247 GACCCTCCTGCACATCACACAGG - Exonic
1020915486 7:14187256-14187278 TACTCACATGCACCTCTGCCTGG + Intronic
1021210714 7:17848552-17848574 GAGTCACAGGCACCTCTGACTGG + Intronic
1025997496 7:66537217-66537239 GACCCACCTGCAGCTCTCTGAGG + Intergenic
1029708054 7:102285942-102285964 GAGCCCCCTGCACCTCTTTCAGG + Intronic
1033611827 7:142970619-142970641 CCTCCACCAGCACCTCTGACAGG - Intergenic
1033654039 7:143361808-143361830 GACCCGCCTGCACCTGTCAGCGG - Intronic
1034188554 7:149196788-149196810 GAAACACCAGCACCTCTTACTGG + Intronic
1035185211 7:157121073-157121095 AACTCCCCTGCACCTCTGTCTGG + Intergenic
1035570388 8:669032-669054 GGCCCATCTACACCTCTGTCTGG + Intronic
1035586643 8:780580-780602 GACTCACGTTCACCACTGACGGG - Intergenic
1035749376 8:1985117-1985139 GAGCCACCTCCCACTCTGACTGG - Intronic
1036227668 8:6973474-6973496 GGCTCAGCTGCAGCTCTGACAGG - Intergenic
1036230121 8:6992633-6992655 GGCTCAGCTGCAGCTCTGACAGG - Intergenic
1036232573 8:7011736-7011758 GGCTCAGCTGCAGCTCTGACAGG - Intronic
1037394134 8:18424194-18424216 TCCCCACCAGCACCTCTTACTGG + Intergenic
1038131405 8:24735986-24736008 TACCCACCTGCCCCACTGACAGG - Intergenic
1038536435 8:28356529-28356551 CTCCCACTGGCACCTCTGACCGG - Intronic
1047749225 8:127867319-127867341 GACCCATCAGCTCCTCTGCCTGG + Intergenic
1049172888 8:141173006-141173028 CAGCCACCTCCGCCTCTGACTGG - Intronic
1049172896 8:141173036-141173058 CAGCCACCTCCGCCTCTGACTGG - Intronic
1049244330 8:141553654-141553676 GCCTCACCTGCACATCTGACAGG - Intergenic
1049338542 8:142099568-142099590 GACCCACCTGCCTCTCTGAAAGG + Intergenic
1049662013 8:143823731-143823753 GGCCCAGCTCCACCTCTGAGAGG + Intronic
1054456674 9:65434722-65434744 GACCCCCCAGCCCCTCTGCCTGG - Intergenic
1057227717 9:93301365-93301387 GACCCACATGGACCTCTGATGGG - Intronic
1058908459 9:109499556-109499578 GACCCCCCTGCAACACTGTCTGG + Intergenic
1061395717 9:130342427-130342449 GACGCAGCTTCACCTCTGGCAGG - Intronic
1062535860 9:137020859-137020881 GCCCCACCCGCACCACTGGCTGG + Exonic
1191716955 X:64200316-64200338 GACCCAGCTGCTCCTCTGTAGGG - Intronic
1192801865 X:74473353-74473375 GAACCACTTCCACCTCTGGCTGG + Intronic