ID: 1069353151

View in Genome Browser
Species Human (GRCh38)
Location 10:67553548-67553570
Sequence GCTGCTAATAAGTAAAATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 149}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069353151_1069353154 5 Left 1069353151 10:67553548-67553570 CCTGCATTTTACTTATTAGCAGC 0: 1
1: 0
2: 1
3: 15
4: 149
Right 1069353154 10:67553576-67553598 AGGAATGGCATTTAAAAATACGG No data
1069353151_1069353156 25 Left 1069353151 10:67553548-67553570 CCTGCATTTTACTTATTAGCAGC 0: 1
1: 0
2: 1
3: 15
4: 149
Right 1069353156 10:67553596-67553618 CGGGAAATAAGATTATTCTCTGG No data
1069353151_1069353155 6 Left 1069353151 10:67553548-67553570 CCTGCATTTTACTTATTAGCAGC 0: 1
1: 0
2: 1
3: 15
4: 149
Right 1069353155 10:67553577-67553599 GGAATGGCATTTAAAAATACGGG No data
1069353151_1069353153 -10 Left 1069353151 10:67553548-67553570 CCTGCATTTTACTTATTAGCAGC 0: 1
1: 0
2: 1
3: 15
4: 149
Right 1069353153 10:67553561-67553583 TATTAGCAGCATTTGAGGAATGG No data
1069353151_1069353157 26 Left 1069353151 10:67553548-67553570 CCTGCATTTTACTTATTAGCAGC 0: 1
1: 0
2: 1
3: 15
4: 149
Right 1069353157 10:67553597-67553619 GGGAAATAAGATTATTCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069353151 Original CRISPR GCTGCTAATAAGTAAAATGC AGG (reversed) Intronic
901095103 1:6672297-6672319 GCTGCTGAGAATTAAAATCCTGG + Intronic
902353260 1:15874890-15874912 GTTGCTACTAAGTGAAATGATGG + Intronic
908441252 1:64156922-64156944 GCTGCTAGTAAGTCAAAAGCTGG - Intronic
909753839 1:79197929-79197951 GATTCTAATAAGTAATAAGCAGG - Intergenic
909872437 1:80759615-80759637 GTTGCTAGGAAGTAAAATTCTGG + Intergenic
913446449 1:118955469-118955491 GATGCTAATAAGAATAATTCAGG + Intronic
914344224 1:146784736-146784758 GCTGCTTATACAGAAAATGCGGG + Intergenic
915763077 1:158335219-158335241 GCTGTTATTAAGTAAAATAAGGG + Intergenic
916670809 1:167018360-167018382 CCTACTAATAAGTAAACGGCAGG - Intronic
916982053 1:170148478-170148500 GCTGCAAATAAGTAAAATGAAGG - Intronic
917617276 1:176758932-176758954 TCTGCAAATTAGTAAAATGATGG - Intronic
917810053 1:178649714-178649736 GCTATTAGTAAGTAAAATGAGGG + Intergenic
918901489 1:190425942-190425964 GCTGATTAAAAATAAAATGCTGG - Intronic
921558966 1:216634040-216634062 ACTGCTGACCAGTAAAATGCTGG - Intronic
921782492 1:219182458-219182480 GCTGCTAATAAGAGAGATTCTGG + Intronic
921940301 1:220831993-220832015 GCTGGTATTATGTAGAATGCTGG + Intergenic
923931081 1:238697841-238697863 GCTGCTATTAAGGAAAATAAGGG - Intergenic
1062852046 10:751607-751629 GCTGTGATTAAGTAAAATGAGGG + Intergenic
1063190665 10:3691418-3691440 GGTGCTAATGAATAAAATGCTGG + Intergenic
1065369187 10:24965669-24965691 GCTGCTCAAAAATGAAATGCAGG - Intergenic
1069353151 10:67553548-67553570 GCTGCTAATAAGTAAAATGCAGG - Intronic
1069985646 10:72281256-72281278 GCTTTTAATAAGTAAAACGTGGG + Intergenic
1072643261 10:97230615-97230637 GCTGCTCATATTTATAATGCAGG - Intronic
1074919060 10:117988647-117988669 GTTGCCAATACTTAAAATGCAGG - Intergenic
1076129201 10:128001356-128001378 GCTGATAGTAAGTAAAGTGTAGG + Intronic
1076210857 10:128643763-128643785 GCTGTTATTAAGTAAAATAAGGG + Intergenic
1078723929 11:13910935-13910957 GTTCATAATAAGTAAAATGATGG + Intergenic
1080647903 11:34200103-34200125 GCTGCTAATAAGTTGAAACCTGG + Intronic
1081777769 11:45687907-45687929 CCTCCTAATCAGCAAAATGCTGG + Intergenic
1083073966 11:60017955-60017977 GCAGCTAACAAGTACAATGCTGG - Intergenic
1083507898 11:63177586-63177608 GGTGGTAATAAGTGAAATGGTGG - Intronic
1084230262 11:67747188-67747210 GCTCCTAATGAGTGAAATGGAGG - Intergenic
1084428859 11:69100495-69100517 GCTGCTAATGAGCACAATTCGGG - Intergenic
1086191195 11:84081123-84081145 ACTGCTAATAATTAAAGTGTTGG - Intronic
1089161787 11:116443879-116443901 GCCACTATTAAGTAAAATGAGGG - Intergenic
1089391495 11:118104950-118104972 GTTGCTTATAAGTGAAATGCTGG - Intronic
1093517386 12:20004547-20004569 CTTGCTAATAAGTCAGATGCCGG - Intergenic
1094543646 12:31383938-31383960 CCTGCAAATAAATTAAATGCTGG - Exonic
1096878048 12:54645668-54645690 GCAGCTCAAAAGGAAAATGCAGG - Exonic
1101402104 12:104397459-104397481 GCTGCTATAAAGAAAAATGAGGG + Intergenic
1101419880 12:104541986-104542008 GTTGCTAGAAAGTAAAATGCAGG - Intronic
1102088248 12:110162083-110162105 CATTCTAATAAATAAAATGCAGG - Intronic
1102304390 12:111793383-111793405 ACTGCTCAAAAGTAAAATCCAGG - Intronic
1102545358 12:113650536-113650558 GCTGCTTTTAAGTAGAAGGCAGG - Intergenic
1102940597 12:116937884-116937906 GGTGCTATAAAGCAAAATGCTGG + Intronic
1103157334 12:118697279-118697301 GCTCCTAAAAATTAAATTGCTGG + Intergenic
1104420968 12:128634775-128634797 GGTGCTAAAACCTAAAATGCAGG - Intronic
1106218427 13:27723601-27723623 GCTGCTATTAAGAAGAATGAAGG - Intergenic
1111898546 13:94171674-94171696 GCTGGTAACAACTAAAATGCAGG - Intronic
1115711131 14:36052211-36052233 TCTGCAAATAAGTAAAAATCAGG + Intergenic
1117137589 14:52752795-52752817 GCTTCTAAGAAGGAAAATTCAGG + Intronic
1117199842 14:53378228-53378250 GCCATTAATAAGTAAAATACGGG + Intergenic
1119812880 14:77538535-77538557 ACTACTAATAAGTGAAATTCAGG - Intronic
1120322913 14:82988516-82988538 GCTGTAAATACGTAAAGTGCCGG - Intergenic
1121907376 14:97758665-97758687 GCTGGTAATGAGGAAAGTGCCGG - Intronic
1122567944 14:102675464-102675486 GCTGTTAGTAAGTAAAATACAGG + Intronic
1130983569 15:88829628-88829650 GCTGCAAATAAGTGATGTGCTGG + Intronic
1137662124 16:50217027-50217049 GTTTCTAATAAGAAAATTGCTGG - Intronic
1139415384 16:66803982-66804004 GCTGCTAAAAAGTAGCATGAGGG - Intronic
1139989773 16:70930613-70930635 GCTGCTTATACAGAAAATGCGGG - Intronic
1142584603 17:963774-963796 ACAGTTAATAAATAAAATGCTGG + Intronic
1143536506 17:7543596-7543618 GCTGCAAATAAGTAAGATGAGGG + Intergenic
1146985815 17:37216773-37216795 GGTCCTAATAAGTAAGATACAGG + Intronic
1147319792 17:39639239-39639261 TTTGCCAATAAATAAAATGCTGG + Intronic
1149600271 17:57888956-57888978 GCTGCTAATGGGGAAAATGTCGG - Intronic
1151427588 17:74041078-74041100 GCTGCTAATCTGTAAAGTGGGGG - Intergenic
1151635401 17:75344279-75344301 GCTGCTATTAACTAAAACACTGG + Intronic
1152487905 17:80607027-80607049 GCTGCTAAGAAGTAATGTGTGGG - Intronic
1153002420 18:467639-467661 GCAGCTAATTATTCAAATGCAGG - Intronic
1153368351 18:4285172-4285194 GTTGCTAAAAAGTAGAATGAAGG + Intronic
1154129217 18:11722568-11722590 ACTGATAATAAATAAAATGTTGG + Intronic
1156783005 18:40875018-40875040 GTTGCTAATTAGTAAGGTGCTGG - Intergenic
1160099027 18:75903401-75903423 GATGGTAATAAGTAAAAGACGGG - Intergenic
925244053 2:2363768-2363790 GCTGTTAATAAGGAAGATGAGGG - Intergenic
928216690 2:29367408-29367430 TCTGCTAATCTGTAAAATGAGGG + Intronic
930070721 2:47363988-47364010 GCAGCAAATTAGCAAAATGCAGG - Intronic
930854689 2:56001373-56001395 GCTGCTAATCTTTAAAGTGCTGG + Intergenic
931492566 2:62764822-62764844 GCTGCTTAAAGGCAAAATGCTGG + Intronic
932055083 2:68435114-68435136 GCTGCTCATAGGTCAAATGATGG - Intergenic
932927881 2:75997670-75997692 TGTACTAGTAAGTAAAATGCTGG + Intergenic
933469673 2:82705750-82705772 GCTGCTAAGAAACAAAAGGCTGG - Intergenic
935467216 2:103412737-103412759 GAAGCTAATAAGGAATATGCTGG - Intergenic
938750748 2:134327408-134327430 GCTGCTATTAAGCAAAATGAGGG + Intronic
939107570 2:137967108-137967130 GCTGTTAACAAATAAAATACTGG + Intronic
939907077 2:147930266-147930288 GCTACATTTAAGTAAAATGCAGG + Exonic
940078140 2:149767251-149767273 GCAGCAAATAAATAAAATGAAGG - Intergenic
945053347 2:205846794-205846816 CCTGCTAATAAGAACTATGCAGG - Intergenic
947396395 2:229691072-229691094 GCTGAGAATAACTAAAAAGCTGG + Intronic
1169554043 20:6730979-6731001 GCTTCTAAAAGGTAAAATGTTGG - Intergenic
1174990781 20:55506769-55506791 GCTGTTAAAAAGTGAAATGGTGG + Intergenic
1177198739 21:17930326-17930348 GCTGCTAATAAGATGAAAGCAGG - Intronic
1181137122 22:20775930-20775952 TCTCCTGATATGTAAAATGCTGG + Intronic
1182252815 22:29015088-29015110 TCTGCTAAGAAATAAAATGAAGG + Intronic
1182896951 22:33866971-33866993 GCTGAGAATACGTAATATGCTGG - Intronic
1184323482 22:43762526-43762548 ACTGAAAATAATTAAAATGCTGG - Intronic
1184635613 22:45826582-45826604 GTTTCTAATAAGAAAACTGCTGG - Intronic
949189133 3:1230649-1230671 GCTTCTAATCTGTAAAATGGGGG - Intronic
949677390 3:6471435-6471457 GCTGCTAATAACAAAAATGAAGG + Intergenic
950120932 3:10482242-10482264 GCTTCTTATCAGTAAAATGGGGG - Intronic
950587051 3:13900483-13900505 GCTTTTAAAAAGTAAAATCCAGG - Intergenic
951802163 3:26607900-26607922 GCTGTTGATAAGTGAAATGAAGG + Intergenic
955499993 3:59574002-59574024 GCTTTTAATAAGTACAATACAGG + Intergenic
955519586 3:59762024-59762046 GCTGTTATTAAGGAAAATGAAGG + Intronic
955820839 3:62894003-62894025 GCTGTTATTAAGTAAAATAAGGG + Intergenic
957773037 3:84719084-84719106 CCTGGTATTAAGTAAAATGTAGG - Intergenic
959242299 3:103812031-103812053 TTTTCTAATAAGTAGAATGCTGG + Intergenic
965787389 3:172350197-172350219 TCGGTTAATATGTAAAATGCTGG - Intronic
965984903 3:174738986-174739008 GCTGCTAATCAGTAATTTACAGG - Intronic
968223628 3:196958144-196958166 GCTGAAAATAACTAAAATGCTGG - Intronic
968863829 4:3194874-3194896 GCTACTAACAATTATAATGCTGG + Intronic
969940658 4:10727734-10727756 GCAACGAATAAGTAAAATACTGG + Intergenic
970227474 4:13874710-13874732 CCTGCAAATTTGTAAAATGCTGG - Intergenic
970442776 4:16096813-16096835 GCAGCAAATAAGAAAATTGCAGG + Intergenic
972584940 4:40429181-40429203 GCTGATATTAAGTAAAATAAGGG - Intronic
975523732 4:75327237-75327259 GTTGATAATAAGGAAAATGATGG - Intergenic
975656704 4:76648501-76648523 GCTGCTAAAAAAAAAAATGCAGG - Intronic
975689827 4:76951547-76951569 CCTGCTAATAAGTATAATGGGGG - Intronic
977672011 4:99706192-99706214 TTTGCTATTAAGTAAAATGTTGG - Intergenic
978415244 4:108467971-108467993 GCTACTAATAAGTAAAAAATTGG - Intergenic
979050692 4:115927847-115927869 ATGGCTAATAAGTAAAATACAGG + Intergenic
979370567 4:119881247-119881269 GCTCTTAATAAGGAAAAAGCAGG + Intergenic
984109735 4:175597182-175597204 GCTGCAAATATCTAAAATGTTGG + Intergenic
986114649 5:4760357-4760379 GCTACTAATAATTAAAAGGTTGG + Intergenic
994186789 5:96823893-96823915 GCTGTTATTAAGTAAAATAAGGG + Intronic
999923642 5:156350907-156350929 ACAGCTAGTAAGTAAAACGCTGG + Intronic
1003171032 6:3722351-3722373 GCTGCCAAAAAGAAAAATGGAGG + Intergenic
1004677879 6:17862197-17862219 GCTGGTAAGAAGTAAAACTCAGG - Intronic
1009705574 6:67246395-67246417 GCTGTTATTAAGTAAAATAAGGG - Intergenic
1013064008 6:106665688-106665710 AGTGCTAATAAGTACAATACAGG - Intronic
1014763318 6:125382159-125382181 GCAGCTAGTAAGTAAAAAACTGG - Intergenic
1015073106 6:129121528-129121550 ACTTCTAATATGTAAAATTCAGG - Intronic
1017410820 6:154165958-154165980 CCTGCCAATAATTAACATGCAGG + Intronic
1022620677 7:31980886-31980908 GCTGCTTATAAGTGAGAGGCAGG - Intronic
1023070686 7:36429576-36429598 GATGCTAATTAACAAAATGCTGG + Intronic
1028072295 7:86465934-86465956 GATTATAATTAGTAAAATGCAGG + Intergenic
1028093372 7:86730503-86730525 GCTCCTAAGAAGTCAACTGCTGG - Intronic
1031916729 7:127570203-127570225 GCTACTAATAAGTAATCTGTGGG - Intergenic
1031920418 7:127596093-127596115 TCTGCTAATAAGGAAGATCCTGG + Intronic
1035795051 8:2348280-2348302 GCTCCTGATAACTCAAATGCAGG - Intergenic
1037507816 8:19549883-19549905 GTTGCTAAGAAGTCAGATGCTGG + Intronic
1037517920 8:19652249-19652271 GCTATTAAAAAGTAAAAAGCAGG - Intronic
1039772643 8:40703125-40703147 ACTGCTTCTAAGTAAAATTCAGG - Intronic
1040523270 8:48195949-48195971 GCTGTTACTAAGTAAAATAAGGG - Intergenic
1043173602 8:76996904-76996926 GCTGGTAATAAGTAAATTTATGG + Intronic
1044650491 8:94489110-94489132 ACTTCTGATAAGTAAAATTCTGG + Intronic
1047572917 8:126120555-126120577 GCTGTTATTAAGTAAAATAAGGG + Intergenic
1048491261 8:134895957-134895979 GGTGCTGGTAAGTAAAATGGAGG - Intergenic
1048619393 8:136115149-136115171 GCAGATATTAAGTTAAATGCTGG + Intergenic
1050807845 9:9704271-9704293 GCTGCAATAAAGTAGAATGCTGG - Intronic
1051712440 9:19945771-19945793 GCTGCTGATAATTAAAATGGAGG + Intergenic
1052253014 9:26422268-26422290 GCTGCTTATAAGTAAAAAAATGG - Intergenic
1057997471 9:99831319-99831341 ACTGCTAAGAATTTAAATGCTGG + Intronic
1062077780 9:134601245-134601267 TCTGCTCAGAAGTAAAATGGTGG - Intergenic
1185856337 X:3539650-3539672 TCTGCTTATAATTTAAATGCTGG - Intergenic
1186063128 X:5732141-5732163 GGTGTTAAAAAGTAAAATGTGGG + Intergenic
1187017107 X:15340805-15340827 GCAACTAATAAATAAAATGAAGG - Intergenic
1189863808 X:45301785-45301807 GCAGCTAAAAAGTAAAAGGGGGG + Intergenic
1192718347 X:73666480-73666502 GCTGCCAATAAATATAAAGCAGG - Intronic
1193260223 X:79397550-79397572 CCTGGTCTTAAGTAAAATGCTGG - Intergenic
1195281153 X:103334304-103334326 GCTCCTAAAAAGTAAAATGGGGG + Intergenic
1195486997 X:105420686-105420708 GCTTCTAATAACTTAAATGTTGG + Intronic
1195811663 X:108839747-108839769 GCTGTTATTAAGTAAAATAAGGG - Intergenic
1195816928 X:108897772-108897794 GCTGCTAATAAGAAAATACCTGG - Intergenic
1195946301 X:110216233-110216255 GCTGTTAATAAGTAATAAGAAGG - Intronic
1197802111 X:130361850-130361872 GCTGTTAATATGTAAAAATCAGG - Intronic
1198969264 X:142263259-142263281 CATTCTAATAAGTAAAATGAAGG + Intergenic