ID: 1069355083

View in Genome Browser
Species Human (GRCh38)
Location 10:67575655-67575677
Sequence GAGATTCTTTGGATTCTAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069355077_1069355083 7 Left 1069355077 10:67575625-67575647 CCTTGTATCATACTTGCCTACTC 0: 1
1: 0
2: 0
3: 10
4: 112
Right 1069355083 10:67575655-67575677 GAGATTCTTTGGATTCTAGTGGG No data
1069355075_1069355083 24 Left 1069355075 10:67575608-67575630 CCCACTGCTCATTTCTGCCTTGT 0: 1
1: 0
2: 0
3: 36
4: 348
Right 1069355083 10:67575655-67575677 GAGATTCTTTGGATTCTAGTGGG No data
1069355076_1069355083 23 Left 1069355076 10:67575609-67575631 CCACTGCTCATTTCTGCCTTGTA 0: 1
1: 0
2: 2
3: 71
4: 765
Right 1069355083 10:67575655-67575677 GAGATTCTTTGGATTCTAGTGGG No data
1069355078_1069355083 -9 Left 1069355078 10:67575641-67575663 CCTACTCCAAGCCAGAGATTCTT 0: 1
1: 0
2: 0
3: 24
4: 233
Right 1069355083 10:67575655-67575677 GAGATTCTTTGGATTCTAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069355083 Original CRISPR GAGATTCTTTGGATTCTAGT GGG Intronic
No off target data available for this crispr