ID: 1069359695

View in Genome Browser
Species Human (GRCh38)
Location 10:67627349-67627371
Sequence GAACCCAGGACAACTAGAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069359693_1069359695 -8 Left 1069359693 10:67627334-67627356 CCACATGGGTACTCAGAACCCAG 0: 1
1: 0
2: 1
3: 30
4: 192
Right 1069359695 10:67627349-67627371 GAACCCAGGACAACTAGAGTAGG No data
1069359688_1069359695 14 Left 1069359688 10:67627312-67627334 CCCTTCGTAGTCATCCTGGGTGC No data
Right 1069359695 10:67627349-67627371 GAACCCAGGACAACTAGAGTAGG No data
1069359685_1069359695 18 Left 1069359685 10:67627308-67627330 CCTACCCTTCGTAGTCATCCTGG 0: 1
1: 0
2: 2
3: 4
4: 78
Right 1069359695 10:67627349-67627371 GAACCCAGGACAACTAGAGTAGG No data
1069359692_1069359695 0 Left 1069359692 10:67627326-67627348 CCTGGGTGCCACATGGGTACTCA 0: 2
1: 0
2: 3
3: 21
4: 140
Right 1069359695 10:67627349-67627371 GAACCCAGGACAACTAGAGTAGG No data
1069359689_1069359695 13 Left 1069359689 10:67627313-67627335 CCTTCGTAGTCATCCTGGGTGCC No data
Right 1069359695 10:67627349-67627371 GAACCCAGGACAACTAGAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069359695 Original CRISPR GAACCCAGGACAACTAGAGT AGG Intronic
No off target data available for this crispr