ID: 1069361578

View in Genome Browser
Species Human (GRCh38)
Location 10:67649027-67649049
Sequence CCAGAGCCAATCTGTGCAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069361573_1069361578 7 Left 1069361573 10:67648997-67649019 CCTATTCCTGTGGTGACCTTTCT 0: 1
1: 0
2: 0
3: 15
4: 212
Right 1069361578 10:67649027-67649049 CCAGAGCCAATCTGTGCAATAGG No data
1069361574_1069361578 1 Left 1069361574 10:67649003-67649025 CCTGTGGTGACCTTTCTGCATAG 0: 1
1: 0
2: 0
3: 9
4: 103
Right 1069361578 10:67649027-67649049 CCAGAGCCAATCTGTGCAATAGG No data
1069361575_1069361578 -9 Left 1069361575 10:67649013-67649035 CCTTTCTGCATAGCCCAGAGCCA 0: 1
1: 0
2: 1
3: 21
4: 255
Right 1069361578 10:67649027-67649049 CCAGAGCCAATCTGTGCAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069361578 Original CRISPR CCAGAGCCAATCTGTGCAAT AGG Intronic
No off target data available for this crispr