ID: 1069363298

View in Genome Browser
Species Human (GRCh38)
Location 10:67669143-67669165
Sequence AGCCCACTGCTGTAATTTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 100}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069363298_1069363302 9 Left 1069363298 10:67669143-67669165 CCCCTAAATTACAGCAGTGGGCT 0: 1
1: 0
2: 1
3: 8
4: 100
Right 1069363302 10:67669175-67669197 TAATATTCACACCAATTGACAGG No data
1069363298_1069363304 25 Left 1069363298 10:67669143-67669165 CCCCTAAATTACAGCAGTGGGCT 0: 1
1: 0
2: 1
3: 8
4: 100
Right 1069363304 10:67669191-67669213 TGACAGGTATAGTGCAAGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069363298 Original CRISPR AGCCCACTGCTGTAATTTAG GGG (reversed) Intronic
902043575 1:13509623-13509645 ACCCCTCTGCTGGAATTCAGGGG - Intronic
902223780 1:14983424-14983446 AGCCAGCTGGTGTACTTTAGGGG - Intronic
902942760 1:19812522-19812544 AGCTGACTGCTGGAATTTGGAGG + Intergenic
905537196 1:38731603-38731625 TGACCACTTCTGTAATTGAGAGG - Intergenic
907889430 1:58623348-58623370 AGCCCGCTGCTGTACTGTGGGGG + Intergenic
908571379 1:65414144-65414166 AGCCCACTGTAATAATTTAATGG - Exonic
911434576 1:97840302-97840324 AGCCCAGTGCTGTAATATTTTGG + Intronic
912311735 1:108629128-108629150 AAGCCACTGTTGTAATTTGGAGG + Intronic
916273791 1:162971902-162971924 AGTCAGCTGCTGTGATTTAGTGG + Intergenic
917742856 1:177977968-177977990 AACCCACTCCTGTAATTAATAGG - Intronic
917780591 1:178391919-178391941 AGTCCACTACTATAATTTTGGGG - Intronic
919449024 1:197747827-197747849 ACCCCACTCCTGTGATTCAGGGG + Intronic
920090203 1:203447299-203447321 AGCTCCCTTCTTTAATTTAGAGG + Intergenic
920825901 1:209423998-209424020 TGCCCACTGCTGTATTTCTGGGG - Intergenic
921867700 1:220104013-220104035 TGCCCACTGCTGGAATGCAGTGG + Intronic
923650451 1:235868021-235868043 TGCCCACTGATGTGGTTTAGAGG + Intronic
1063759414 10:9056662-9056684 AGCCCACTGCTGTGCTGTGGGGG + Intergenic
1065901626 10:30213379-30213401 ATCCCACTGTTGTATTTTAGAGG - Intergenic
1066364428 10:34763110-34763132 AGGTCACTGCTGGTATTTAGTGG + Intronic
1066617083 10:37306133-37306155 AACCCACTGCAGTAAATTACAGG - Intronic
1068956855 10:62826173-62826195 AGGCCACTGCTCTAACTTAGAGG + Intronic
1069363298 10:67669143-67669165 AGCCCACTGCTGTAATTTAGGGG - Intronic
1071170156 10:82854897-82854919 AGCCAAATACTGTAATGTAGTGG - Intronic
1071983781 10:91030520-91030542 AACCCAGTGCTGTGATTCAGTGG - Intergenic
1077532864 11:3105440-3105462 AGCCCAGTGCTGTAGCTTTGGGG + Intronic
1080073407 11:28116978-28117000 AGCTCAATGCTGTCATGTAGTGG + Intronic
1085768996 11:79308609-79308631 AGGTCACTGCTGTCAATTAGAGG - Intronic
1088027750 11:105207105-105207127 TGCCCACTGCTGTCATTCAGAGG + Intergenic
1098445475 12:70561901-70561923 GGCCCACTGCTGTAATGTGACGG - Intronic
1098463025 12:70754132-70754154 AGCCCACTGCTTGATATTAGTGG - Intronic
1100161267 12:91864024-91864046 AGCCCACTGCTTGAATCTAAGGG + Intergenic
1101894949 12:108749376-108749398 AGGCCAGTGGTGTAGTTTAGAGG + Intergenic
1103453842 12:121049326-121049348 AGCTCACTTTTGTATTTTAGTGG - Intergenic
1106903389 13:34378983-34379005 AGCCCACCTCTGCCATTTAGAGG + Intergenic
1107653719 13:42571052-42571074 AGCCCAGTGCTGGCATATAGTGG + Intronic
1108010061 13:45997504-45997526 AGTCCACTGGTGGATTTTAGGGG - Intronic
1115811004 14:37107184-37107206 CACCCACTGCTGTATTTCAGAGG - Intronic
1119495820 14:75077980-75078002 AGCCCAAGGTTGTAATTTAGTGG - Exonic
1121362795 14:93277390-93277412 AGCCCTCTACTGTAATGCAGGGG + Intronic
1123027356 14:105432993-105433015 AACCCCGTGCTGTAATATAGGGG + Intronic
1129718672 15:77866044-77866066 AGCCCTCAGCCGTAATTTACTGG - Intergenic
1130460251 15:84154822-84154844 AGCCCTCAGCCGTAATTTACCGG + Intergenic
1135339006 16:21630395-21630417 AGCCCACGGCTGCACTGTAGGGG - Intronic
1139193391 16:64890983-64891005 GGCCCAGTTCTGTAATTAAGTGG - Intergenic
1146948470 17:36890027-36890049 ATCCCCCTGCTGTAATTTCTGGG + Intergenic
1147723159 17:42551077-42551099 AGGCTACTGCTGTAATTGAAGGG - Exonic
1147724368 17:42557303-42557325 AGGCTACTGCTGTAATTGAAGGG - Intergenic
1148922022 17:51045732-51045754 AGCCATCTTCTGTATTTTAGAGG - Intronic
1149937279 17:60820430-60820452 AGCCCACTGATGCAATTCATAGG + Intronic
1151981490 17:77512630-77512652 AACCCACACTTGTAATTTAGGGG + Intergenic
1155369174 18:25079869-25079891 AGCACACTGCTGATATTTAATGG + Intronic
1157846204 18:51006208-51006230 AGCCCACTGCTGCAATTCTTTGG - Intronic
1159116153 18:64115094-64115116 AGCCGTGTGCTGAAATTTAGGGG + Intergenic
1162180255 19:8863856-8863878 ACCCCACTGCTGTTATTAACAGG - Intronic
1164546715 19:29171557-29171579 AGAACACTGCTGAAATTAAGGGG + Intergenic
930418750 2:51122214-51122236 AGCCCATTGCTGTAATTTTTTGG - Intergenic
932458156 2:71862909-71862931 AGCCTACTGCTGGACTTTATAGG - Intergenic
934669961 2:96205476-96205498 AGCCAAAGGCTGTGATTTAGGGG + Intronic
937711632 2:124986291-124986313 TGCCCAGTGCTGTAGCTTAGTGG + Intergenic
938812584 2:134867226-134867248 ATCCCACAGCTGAAATGTAGGGG - Intronic
940607800 2:155950260-155950282 AGCTCACTGTTGTAATTTGTGGG - Intergenic
942123114 2:172798145-172798167 AAGCCAGTGCTGTACTTTAGAGG - Intronic
943919166 2:193680096-193680118 AGCCCACTGCCCTCATTTTGAGG - Intergenic
948879371 2:240848659-240848681 AGACCACTGCTGTGTGTTAGAGG + Intergenic
1169979501 20:11367182-11367204 GGGCCACTGCATTAATTTAGGGG + Intergenic
1173279396 20:41615039-41615061 AGCGTACTGTTGTATTTTAGTGG - Intronic
1178068147 21:28930135-28930157 ATTCCAATTCTGTAATTTAGGGG + Exonic
1181159762 22:20952195-20952217 AGTCAACTGCTGTAATTCAAAGG - Exonic
1182099220 22:27646090-27646112 AGCCCTCTGGAGTAATTTACGGG - Intergenic
952226246 3:31379657-31379679 AACCCAATGATATAATTTAGAGG - Intergenic
954601511 3:51874249-51874271 TGCCCAGTGCTGAACTTTAGAGG - Intronic
961935853 3:130582895-130582917 ACACCACTGGTGTCATTTAGAGG - Intronic
963237104 3:142966500-142966522 AAGCCACTGCTGGCATTTAGAGG + Intronic
963669721 3:148236292-148236314 TGACCACTGCTGTATGTTAGAGG - Intergenic
967687638 3:192436328-192436350 AGCTTACTGCTGTAAATTAGGGG + Intronic
969103459 4:4787428-4787450 TGCCCTCTGCTGTAAGTCAGGGG + Intergenic
969362293 4:6672641-6672663 AGCCCACTGCTGCACTGTGGAGG + Intergenic
970659831 4:18272460-18272482 AGCCCTATGCTGTAAGTGAGTGG - Intergenic
972601037 4:40572851-40572873 GGCCCACTTCTGCAATTTTGTGG - Intronic
972669865 4:41204776-41204798 AGGCCACTGCTCTCATTCAGGGG + Intronic
973138873 4:46741376-46741398 ATACTACTGCTGTTATTTAGTGG - Intronic
977223327 4:94364501-94364523 AGACCACTGCTGTAATCAACTGG - Intergenic
981969378 4:150648427-150648449 AGCAGACTACTGTTATTTAGTGG + Intronic
993598574 5:89890857-89890879 AGCAAAATGCTGTAATATAGGGG - Intergenic
994998089 5:107090516-107090538 AGCCCACTGAAGTATTTTAAAGG - Intergenic
995707343 5:114999253-114999275 AGCCCACTGCTGCACTGTGGGGG + Intergenic
996057887 5:119000674-119000696 TGCCCAATGCTGTAGCTTAGTGG - Intergenic
996789514 5:127277680-127277702 AGACCACTGCATTAATTCAGGGG + Intergenic
1001572476 5:172739250-172739272 AGCCCACAACAGGAATTTAGGGG + Intergenic
1003954843 6:11152779-11152801 ATCCCACTGCTTTAATTTAGAGG - Intergenic
1004078971 6:12372081-12372103 AGCCAACTGAAGTAATCTAGTGG + Intergenic
1005935484 6:30517885-30517907 AGCCCACTGCTGTGCTGTGGGGG + Intergenic
1007428264 6:41760936-41760958 AGGCTACTGCTATAATCTAGAGG - Intergenic
1008623861 6:53298794-53298816 AGCTCACTGATGGCATTTAGTGG - Intronic
1014138551 6:117915815-117915837 AGGCTACTGCAGTCATTTAGAGG + Intronic
1014459323 6:121676774-121676796 AGCCCATTGCTGTGATGGAGGGG + Intergenic
1014685307 6:124490806-124490828 AGCCCTCTGCTCTCATTTACAGG - Intronic
1017066929 6:150537633-150537655 AGCACCCTGCTGTACTTTCGAGG - Intergenic
1020656474 7:10934106-10934128 AATGAACTGCTGTAATTTAGAGG + Intronic
1021265684 7:18518675-18518697 AGCCGACTGCTGTATTTAACTGG + Intronic
1022146424 7:27546562-27546584 AGCCTACTTCTGTTATTTATAGG - Intronic
1023961570 7:44931490-44931512 AACACATTGCTGTAATTTTGAGG - Intergenic
1025982898 7:66421969-66421991 AGCCCACTGCTTGGACTTAGTGG - Intergenic
1034089407 7:148350080-148350102 AGGCCACTGCTGGAGTTTAGTGG + Intronic
1045078462 8:98597524-98597546 AGAACAATGCTATAATTTAGAGG + Intronic
1058815823 9:108681866-108681888 AGAACATTGCTGTAATTTGGAGG - Intergenic
1061165208 9:128918363-128918385 AGTGCACTGCTGGAATATAGTGG + Intergenic
1186412869 X:9359264-9359286 AGCCCTCTGCTGTACTTTAAGGG - Intergenic
1199003173 X:142663939-142663961 AGCCTTCTGCTGTAATTGTGAGG + Intergenic
1201947861 Y:19531292-19531314 AGCCCCCACCTGTATTTTAGAGG + Intergenic