ID: 1069367235

View in Genome Browser
Species Human (GRCh38)
Location 10:67706582-67706604
Sequence GGACATCTGGTCAGTGCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069367228_1069367235 -8 Left 1069367228 10:67706567-67706589 CCAAGTCCCTTGGGAGGACATCT No data
Right 1069367235 10:67706582-67706604 GGACATCTGGTCAGTGCTGGGGG No data
1069367220_1069367235 30 Left 1069367220 10:67706529-67706551 CCAGAGCAGAAGTGATGAAAAAA No data
Right 1069367235 10:67706582-67706604 GGACATCTGGTCAGTGCTGGGGG No data
1069367224_1069367235 -1 Left 1069367224 10:67706560-67706582 CCCCATTCCAAGTCCCTTGGGAG No data
Right 1069367235 10:67706582-67706604 GGACATCTGGTCAGTGCTGGGGG No data
1069367227_1069367235 -3 Left 1069367227 10:67706562-67706584 CCATTCCAAGTCCCTTGGGAGGA No data
Right 1069367235 10:67706582-67706604 GGACATCTGGTCAGTGCTGGGGG No data
1069367223_1069367235 0 Left 1069367223 10:67706559-67706581 CCCCCATTCCAAGTCCCTTGGGA No data
Right 1069367235 10:67706582-67706604 GGACATCTGGTCAGTGCTGGGGG No data
1069367225_1069367235 -2 Left 1069367225 10:67706561-67706583 CCCATTCCAAGTCCCTTGGGAGG No data
Right 1069367235 10:67706582-67706604 GGACATCTGGTCAGTGCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069367235 Original CRISPR GGACATCTGGTCAGTGCTGG GGG Intergenic
No off target data available for this crispr