ID: 1069374565

View in Genome Browser
Species Human (GRCh38)
Location 10:67781022-67781044
Sequence GTATAACCAACGCCATAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069374564_1069374565 8 Left 1069374564 10:67780991-67781013 CCTCAGCACAGTTCTGGGCATTG No data
Right 1069374565 10:67781022-67781044 GTATAACCAACGCCATAGCATGG No data
1069374561_1069374565 30 Left 1069374561 10:67780969-67780991 CCTGGACAAGCACTTTAGTTGTC No data
Right 1069374565 10:67781022-67781044 GTATAACCAACGCCATAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069374565 Original CRISPR GTATAACCAACGCCATAGCA TGG Intergenic
No off target data available for this crispr