ID: 1069384956

View in Genome Browser
Species Human (GRCh38)
Location 10:67875789-67875811
Sequence TTTTGCCCTCCATCCCCTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069384956_1069384961 20 Left 1069384956 10:67875789-67875811 CCTCTAGGGGATGGAGGGCAAAA No data
Right 1069384961 10:67875832-67875854 GATCTAGGTTTATATACTGCTGG No data
1069384956_1069384962 23 Left 1069384956 10:67875789-67875811 CCTCTAGGGGATGGAGGGCAAAA No data
Right 1069384962 10:67875835-67875857 CTAGGTTTATATACTGCTGGTGG No data
1069384956_1069384959 5 Left 1069384956 10:67875789-67875811 CCTCTAGGGGATGGAGGGCAAAA No data
Right 1069384959 10:67875817-67875839 CAGTTGAGAACCACTGATCTAGG No data
1069384956_1069384963 27 Left 1069384956 10:67875789-67875811 CCTCTAGGGGATGGAGGGCAAAA No data
Right 1069384963 10:67875839-67875861 GTTTATATACTGCTGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069384956 Original CRISPR TTTTGCCCTCCATCCCCTAG AGG (reversed) Intergenic
No off target data available for this crispr