ID: 1069384957

View in Genome Browser
Species Human (GRCh38)
Location 10:67875815-67875837
Sequence TAGATCAGTGGTTCTCAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2765
Summary {0: 10, 1: 76, 2: 324, 3: 848, 4: 1507}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069384957_1069384964 5 Left 1069384957 10:67875815-67875837 CCCAGTTGAGAACCACTGATCTA 0: 10
1: 76
2: 324
3: 848
4: 1507
Right 1069384964 10:67875843-67875865 ATATACTGCTGGTGGAAGGCAGG No data
1069384957_1069384962 -3 Left 1069384957 10:67875815-67875837 CCCAGTTGAGAACCACTGATCTA 0: 10
1: 76
2: 324
3: 848
4: 1507
Right 1069384962 10:67875835-67875857 CTAGGTTTATATACTGCTGGTGG No data
1069384957_1069384961 -6 Left 1069384957 10:67875815-67875837 CCCAGTTGAGAACCACTGATCTA 0: 10
1: 76
2: 324
3: 848
4: 1507
Right 1069384961 10:67875832-67875854 GATCTAGGTTTATATACTGCTGG No data
1069384957_1069384963 1 Left 1069384957 10:67875815-67875837 CCCAGTTGAGAACCACTGATCTA 0: 10
1: 76
2: 324
3: 848
4: 1507
Right 1069384963 10:67875839-67875861 GTTTATATACTGCTGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069384957 Original CRISPR TAGATCAGTGGTTCTCAACT GGG (reversed) Intergenic
Too many off-targets to display for this crispr