ID: 1069384958

View in Genome Browser
Species Human (GRCh38)
Location 10:67875816-67875838
Sequence CTAGATCAGTGGTTCTCAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1733
Summary {0: 4, 1: 46, 2: 199, 3: 497, 4: 987}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069384958_1069384964 4 Left 1069384958 10:67875816-67875838 CCAGTTGAGAACCACTGATCTAG 0: 4
1: 46
2: 199
3: 497
4: 987
Right 1069384964 10:67875843-67875865 ATATACTGCTGGTGGAAGGCAGG No data
1069384958_1069384961 -7 Left 1069384958 10:67875816-67875838 CCAGTTGAGAACCACTGATCTAG 0: 4
1: 46
2: 199
3: 497
4: 987
Right 1069384961 10:67875832-67875854 GATCTAGGTTTATATACTGCTGG No data
1069384958_1069384962 -4 Left 1069384958 10:67875816-67875838 CCAGTTGAGAACCACTGATCTAG 0: 4
1: 46
2: 199
3: 497
4: 987
Right 1069384962 10:67875835-67875857 CTAGGTTTATATACTGCTGGTGG No data
1069384958_1069384963 0 Left 1069384958 10:67875816-67875838 CCAGTTGAGAACCACTGATCTAG 0: 4
1: 46
2: 199
3: 497
4: 987
Right 1069384963 10:67875839-67875861 GTTTATATACTGCTGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069384958 Original CRISPR CTAGATCAGTGGTTCTCAAC TGG (reversed) Intergenic
900747383 1:4370239-4370261 GTACATTAGTGGTTCTCAACTGG - Intergenic
900774254 1:4570272-4570294 CTAGATTATTCGTTCTCAATAGG + Intergenic
901247847 1:7747193-7747215 CTAAAGCAGGGGTTTTCAACTGG + Intronic
901484300 1:9547763-9547785 CTAAACCAGTAGTTCTCAATTGG - Intronic
901607177 1:10468296-10468318 TCATATCAGTGGTTCTCAAGTGG + Intronic
902104344 1:14021267-14021289 CTTGGACAATGGTTCTCAACTGG - Intergenic
902173989 1:14635729-14635751 CTAGACCAGTGGTTCTCAACTGG + Intronic
902281848 1:15380418-15380440 CTAGAACAGTGGTTCTCAATTGG - Intronic
902311275 1:15583639-15583661 CTAGATCGGTGATTCTCAAGTGG - Intronic
902745417 1:18470502-18470524 TTAGCTCAGGGGTTCTGAACCGG + Intergenic
902765036 1:18608226-18608248 CTAGAGCAATGCTTTTCAACTGG - Intergenic
902813051 1:18900423-18900445 CTAGAGCACTGGCTCTCAACCGG + Intronic
902852908 1:19175319-19175341 TTAGAGCAATGGTTCTCAATGGG - Intronic
903032616 1:20474804-20474826 TTAGAGCAGTGCTTCTCAGCTGG - Intergenic
903105399 1:21074348-21074370 CTAAGTCAGTTGTTCTCAACTGG - Intronic
903342779 1:22664918-22664940 TGAGGGCAGTGGTTCTCAACAGG - Intergenic
903344495 1:22675807-22675829 CTAGACCAATGTTTCTCAACCGG + Intergenic
903443530 1:23406047-23406069 CTAGACCAGTGGATCTCAGCAGG - Intronic
903508407 1:23854661-23854683 CTAGAGCAGTGGCTGTCAACTGG + Intronic
904229114 1:29052352-29052374 TTAGGGCAGTGGTTCTCAACTGG - Intronic
904608159 1:31710082-31710104 CTACCCCAGTGGTTCTCCACAGG + Intergenic
904809398 1:33153384-33153406 CTAGAGCAGTGGTTCTCAACTGG + Intronic
905697908 1:39989272-39989294 CTAGACCAATGATTCTCCACTGG - Intergenic
905798420 1:40828469-40828491 GTAGAGCAGTGGTTCTCAACTGG - Intronic
905815918 1:40950734-40950756 CTAGCTTAGTGATTCTCACCCGG + Intergenic
906028059 1:42692167-42692189 CTAGAATAGTGATTTTCAACAGG - Intronic
906113871 1:43342577-43342599 CAAGATCAGCCTTTCTCAACTGG - Intronic
906592334 1:47037716-47037738 ACAGGGCAGTGGTTCTCAACTGG - Intronic
907187208 1:52618870-52618892 CCAGAGCAGTGGTTCTTCACCGG + Intergenic
907229501 1:52982597-52982619 TTATCGCAGTGGTTCTCAACTGG - Intronic
907363690 1:53943388-53943410 GTACTCCAGTGGTTCTCAACTGG + Intronic
907810893 1:57868635-57868657 CTACTGCAGTGGTTCTCAACTGG - Intronic
908043770 1:60145670-60145692 CTAGAGCAGTGGCTCTCAATGGG + Intergenic
908185005 1:61644055-61644077 CTAGGGCAGTGGTTCTCAACTGG + Intergenic
908435652 1:64102961-64102983 CTGGACCAATGATTCTCAACAGG - Intronic
908456314 1:64308211-64308233 CTATCCCAGTGGTTCTCAATCGG + Intergenic
908523931 1:64969500-64969522 CTAGACTAGTGGTTCTCAGTGGG - Intergenic
908661259 1:66437944-66437966 TTAGGGCAGTGGTTCTCAACTGG + Intergenic
908815808 1:68032712-68032734 CTTGATGAGTGCTTCTGAACTGG - Intergenic
909272526 1:73642342-73642364 CTGGATCAGAAGTTTTCAACAGG + Intergenic
909319264 1:74262374-74262396 CTAAATCAGTTGTTCTCAACTGG - Intronic
909366835 1:74834469-74834491 CCACAGCAGTGGTTCTCAGCTGG + Intergenic
909537254 1:76751257-76751279 CTTTATCAGTGGATCCCAACTGG + Intergenic
909569624 1:77094232-77094254 CTAGGTCAGTGCTTTTAAACTGG - Intronic
909772454 1:79440982-79441004 TTAGTCCAGTGATTCTCAACTGG + Intergenic
909881852 1:80889699-80889721 TTAGCTCAGTGGCTTTCAACTGG + Intergenic
909892846 1:81029443-81029465 CAAACTCAGTGGTTCTCAACTGG + Intergenic
910447924 1:87317635-87317657 CTAAACCCGTGGTTCTCAACTGG - Intergenic
910781738 1:90944033-90944055 CTATATTAGTTTTTCTCAACAGG + Intronic
911075848 1:93874171-93874193 CAAGGACAGTGGTTCTCAACTGG + Intronic
911506840 1:98763613-98763635 CTAATTCTGTGGTTCTCAGCTGG + Intergenic
911577038 1:99590301-99590323 TTAGAGCAGTAGTTCTCAGCTGG + Intergenic
911627209 1:100137803-100137825 CTGGCCCAGTGGTTCTCAACTGG - Intronic
911693544 1:100862389-100862411 TCAGAGAAGTGGTTCTCAACTGG - Intergenic
911711052 1:101073435-101073457 CAAAAGCAGTGGTTCCCAACTGG - Intergenic
912177402 1:107177023-107177045 TTGGACCAGTGGTTCTCAACTGG - Intronic
912253774 1:108038333-108038355 TTAGAGCAGTGGTTTTCCACTGG - Intergenic
912332229 1:108830371-108830393 CTCTAGCAGTGGTCCTCAACTGG - Intronic
912403935 1:109420714-109420736 CTAGAAGAGTGATTCTCAATTGG + Intronic
912659937 1:111518546-111518568 TTAGATCACTGTTTCTCAACTGG - Intronic
912666134 1:111581330-111581352 CTACAGCAGTTTTTCTCAACCGG + Intronic
913183292 1:116343524-116343546 TTGGATCAATGGTTCCCAACGGG - Intergenic
913190982 1:116412825-116412847 CTTAATTAGTGGTTCTCAACTGG - Intergenic
913276609 1:117144395-117144417 CTAGAGCAGTGGGACTCAGCTGG - Exonic
913280319 1:117179294-117179316 CTAAATCAGTGGTTCTCAGCTGG - Intronic
913370020 1:118087991-118088013 CTAGAGCAGTGGTTCTCAACAGG - Intronic
915019945 1:152769679-152769701 CTAATTCAGTGGTTCTCAATGGG - Intronic
915285567 1:154849950-154849972 TTAGATCAGAGCTTCTCAACTGG - Intronic
915621741 1:157090411-157090433 CTACTTAAGTGGTTCTCCACTGG + Intergenic
915725293 1:158013042-158013064 TTAGCTCAGTGGTTCTCACTTGG - Intronic
915947287 1:160162736-160162758 CTAACACAGTGGTTCTCAACTGG - Intronic
916000139 1:160607577-160607599 CTAGATCAGTGGTTCTCAACTGG + Intergenic
916038617 1:160943333-160943355 CTAGAGCATTGGTTTTCAAATGG - Intergenic
916062725 1:161111581-161111603 CTGTAGCAGTGATTCTCAACTGG - Intronic
916428540 1:164705240-164705262 ATAGATGAATGGTTCTCAACTGG - Intronic
916583609 1:166130449-166130471 TTAATGCAGTGGTTCTCAACTGG + Intronic
916604056 1:166323802-166323824 CAAGAACAGCGCTTCTCAACTGG + Intergenic
916923165 1:169490203-169490225 ATAAATCAGTGGTTCTCAATCGG + Intergenic
917001072 1:170360088-170360110 CTAGAACTGTGATTCTCAACTGG - Intergenic
917124698 1:171676686-171676708 ATAAACCAGTGGTTCACAACCGG - Intergenic
917517041 1:175716787-175716809 CTAGAGCAGTGGTCTTCACCTGG - Intronic
917597227 1:176541369-176541391 TTAGATGTGTGGTTCTCAATGGG + Intronic
917763413 1:178189944-178189966 GTGAACCAGTGGTTCTCAACTGG + Intronic
917833802 1:178923490-178923512 CTATGTCACTGATTCTCAACTGG + Intergenic
918266634 1:182848230-182848252 TTAACTCAGTGTTTCTCAACTGG + Intronic
918333137 1:183479445-183479467 CTAAATCAGTGGTTCTCAACTGG - Intronic
918371947 1:183869889-183869911 GTATGGCAGTGGTTCTCAACAGG + Intronic
918417510 1:184326871-184326893 TTAGAGCAGTGGTTCACAATCGG - Intergenic
918555158 1:185790599-185790621 CTAGAGCAGTGTTTTTCAATGGG + Intronic
918643921 1:186880432-186880454 TTAGTGCAGTGGTTCTAAACTGG + Intronic
918722130 1:187866438-187866460 ATAGTCCAGTGATTCTCAACTGG - Intergenic
919108789 1:193190820-193190842 TTAGAGCTGTGGTTCTCAAGGGG + Intronic
919392514 1:197005174-197005196 CTAGACCAGTGTTTTTCAAAGGG - Intronic
919519796 1:198573475-198573497 CTAGATAATTGGTTCTCAAGGGG - Intergenic
919677213 1:200395315-200395337 CTAAATCAGTGGTTCTCAGCTGG - Intergenic
920307323 1:205027245-205027267 TTAGAGGAGTGGTTCTCAAAGGG + Intergenic
920333159 1:205226903-205226925 CTAGGCCAGTGGTTCTCAAAGGG + Intergenic
920739361 1:208565771-208565793 CTAAACCAGTGATTCTCAACTGG + Intergenic
920881652 1:209886418-209886440 CTGTATCAGTGGTTCTCAACTGG - Intergenic
921393872 1:214647742-214647764 CTATAGCAGTGAGTCTCAACTGG - Intronic
922081903 1:222305509-222305531 GCAGATCATTGGTCCTCAACTGG + Intergenic
922177898 1:223211275-223211297 CTAGCACAGCAGTTCTCAACTGG - Intergenic
922234207 1:223711206-223711228 CTACAGCAGTGGTTCTCAACTGG - Intronic
922236686 1:223727474-223727496 CTCTGCCAGTGGTTCTCAACTGG - Intronic
922438654 1:225632200-225632222 GTAGAACAGTGGTTCTCAGCTGG + Intronic
922638630 1:227203422-227203444 CTAGAACAGGGCTTCTCAACAGG - Intronic
923078603 1:230632561-230632583 CTAGATCAGTGGTTCTCACCTGG - Intergenic
924202818 1:241677624-241677646 ATAAATCTGTGGTTCTTAACTGG + Intronic
924234158 1:241986788-241986810 CTAGACCAGTGGTTCTCAGCCGG + Intergenic
924508870 1:244711899-244711921 CTAGCCCAGTGTTTCTTAACTGG + Intergenic
924671093 1:246126197-246126219 TTAGATCAGTGGTTCTCACTGGG + Intronic
924747424 1:246849063-246849085 GTAGGTCAGAGCTTCTCAACAGG - Intronic
1063498452 10:6531309-6531331 CTAAATCAGTGGTTCTCAGAGGG + Intronic
1063686958 10:8246091-8246113 TTAGACCAGTGATTCTCAAAAGG - Intergenic
1063720701 10:8578529-8578551 CTAAATCAGTGGTTGCAAACTGG - Intergenic
1063728494 10:8667971-8667993 CTGGGTCAGGGGTTCTCAAGTGG + Intergenic
1063857847 10:10274773-10274795 GTAGATCAGTGATCCTCAAAGGG - Intergenic
1064014365 10:11761199-11761221 CTAGATCCGTGGTTCTAAACTGG + Intronic
1064159344 10:12930605-12930627 CTAGAGCACTGATTCTCAACCGG + Intronic
1064460741 10:15532490-15532512 CTAGGTCAGTGGTTCTTAACTGG - Intronic
1064665497 10:17646383-17646405 CTAGTGCAGCGGTTCTCAACTGG - Intronic
1065065164 10:21955149-21955171 TTATATCAGTGATTCTGAACTGG - Intronic
1065706826 10:28478279-28478301 CTAAAACAGTGGTTCTCAACTGG + Intergenic
1065783843 10:29194689-29194711 TTAGAGTAGTGATTCTCAACTGG - Intergenic
1066318444 10:34273909-34273931 CTAGCTCAGTGTTTCTCAACAGG + Intronic
1066377334 10:34869192-34869214 CTAAAACAGTAGTTCTCAACTGG - Intergenic
1067361217 10:45581103-45581125 GTAAGTCTGTGGTTCTCAACAGG + Intronic
1067958942 10:50825846-50825868 TTAGGCCAGTGGTTCTCAACTGG + Intronic
1068043062 10:51851269-51851291 TTAGGTCAGAGATTCTCAACTGG + Intronic
1068330118 10:55554125-55554147 TTAGATCACTGGTTTTGAACAGG - Intronic
1068403121 10:56555801-56555823 CTAGAATACTGGTTCTCAATTGG - Intergenic
1068690605 10:59909951-59909973 CTAGTTCAGTGGTTCCAAACTGG - Intergenic
1068745752 10:60528837-60528859 ATAGATCAGTGATTATTAACAGG - Intronic
1068764593 10:60749010-60749032 CTAGCACAATGGTTCTCAACTGG + Intergenic
1069238586 10:66109524-66109546 CTTGAGCAATGGTTCTCAAGTGG - Intronic
1069384958 10:67875816-67875838 CTAGATCAGTGGTTCTCAACTGG - Intergenic
1069493251 10:68879705-68879727 CTAGAGCAGTGGTTTCCAACTGG + Intronic
1069967466 10:72132667-72132689 TTAAATCAGTGTTTCTCAACTGG - Intronic
1070158334 10:73850382-73850404 CTAGAGCAGTGGTTTTCAACTGG + Intronic
1070371879 10:75790311-75790333 CTAGATCAGTAGTTCTCAACTGG - Intronic
1070396821 10:76018385-76018407 TTAGATCAGTGGTTCTCAAGTGG - Intronic
1070416718 10:76197431-76197453 CTAAACCAGTGGTTCTCAAGTGG + Intronic
1070687905 10:78503337-78503359 CTGCAGCAGTGATTCTCAACCGG + Intergenic
1070978016 10:80621118-80621140 CCATGTAAGTGGTTCTCAACAGG + Intronic
1071194418 10:83141361-83141383 CTGGATAAGTGGTTTTCACCTGG - Intergenic
1071445567 10:85743121-85743143 CTAGATAATTGGTTCTCAATGGG - Intronic
1071599805 10:86953529-86953551 TTAGACCAGTGGTTCTCAATGGG + Intronic
1072156505 10:92728735-92728757 CCAGGACAGTGGTTCTCAACTGG - Intergenic
1072167813 10:92830731-92830753 CTAGGCTAGTGGTTCTCAACTGG - Intergenic
1072178425 10:92953442-92953464 CTAAGGCAGTAGTTCTCAACTGG + Intronic
1072248383 10:93562767-93562789 CTAGAGCAGTGCATCTTAACTGG - Intergenic
1072256444 10:93625880-93625902 GTAGACCAGTGGTTCTCAACTGG + Intronic
1072342145 10:94462495-94462517 TTAGATCAGTAATTCTCAACTGG - Intronic
1072356259 10:94614588-94614610 ATAGATCAGTGATTCTCAGTTGG + Intergenic
1072442564 10:95469969-95469991 GTAGTTCAGTGGTTCTCGACAGG - Intronic
1072490430 10:95900267-95900289 CTAAATCAGGGTTTCTCAACTGG + Intronic
1072566656 10:96621966-96621988 CTAAAGCAGTGGTTCTCAATTGG - Intronic
1072642940 10:97226906-97226928 CTAAATCAGTGGTTCTCATGTGG + Intronic
1072894128 10:99351016-99351038 TTAAAGCAGTGGTTCTCAAATGG - Intronic
1073239589 10:102047813-102047835 CCAGATCAGTGATTCTCAACTGG + Intronic
1073302239 10:102477938-102477960 CTAGAGCAGTGGTTCCCAATTGG - Intergenic
1073415131 10:103374774-103374796 TTATTGCAGTGGTTCTCAACTGG + Intronic
1073605430 10:104890886-104890908 CTAAATCAGTAGTTCTCAACTGG - Intronic
1073912793 10:108366527-108366549 CCAGATCAATAGATCTCAACTGG + Intergenic
1074088140 10:110224326-110224348 CTAGATCCCTTGTTCCCAACTGG + Intronic
1074119340 10:110481799-110481821 CTAGACCAGTGGTCCTCACAGGG - Intergenic
1074313363 10:112341345-112341367 TTAGAGCAGTGATTCTCCACAGG + Intergenic
1074851087 10:117440193-117440215 CTAGAGAAGTGGTTCTCAACTGG - Intergenic
1075025374 10:118979993-118980015 CTAGGGATGTGGTTCTCAACTGG - Intergenic
1075215488 10:120529096-120529118 CTAGGGCAGTGGTTCTCCACTGG + Intronic
1075282105 10:121147959-121147981 CTAGAACTGTGGTTCTCACAGGG - Intergenic
1075418758 10:122285500-122285522 ATAGCCCAGTAGTTCTCAACAGG + Intronic
1075435771 10:122440272-122440294 CTAGGACAGTGTTTCTCAAATGG - Exonic
1075507543 10:123038086-123038108 TTAGACCAGCGGTTCTCAAATGG + Intronic
1076076878 10:127540390-127540412 CTAGAATAGTGGTTCTCAACTGG + Intergenic
1076310760 10:129506038-129506060 CTAGGCCAGTGGTTTTCAACTGG + Intronic
1076529689 10:131136115-131136137 CTAGACCAGTGGCTCTCAACTGG - Intronic
1077294383 11:1818463-1818485 CTAGGGCAGTGGTCCTCAACTGG + Intergenic
1077601386 11:3577360-3577382 GTAGACCAATGGCTCTCAACTGG + Intergenic
1077658433 11:4044824-4044846 TTAGAGCAGTGGTTCTCAGCTGG + Intronic
1077749084 11:4943686-4943708 CTTAAACAGTGGTTCTCAACTGG - Intronic
1077807722 11:5606049-5606071 AATGAACAGTGGTTCTCAACTGG - Intronic
1077990445 11:7405384-7405406 TTCAATCAGTGGTTCTCAACCGG - Intronic
1078145625 11:8720159-8720181 CTAAAGCAGTGGTTCTCAGTTGG - Intronic
1078265534 11:9753718-9753740 CTATCACAGTGGTTCTCAACTGG + Intergenic
1078287691 11:9974444-9974466 TTAGAGCAGTGGTTCTCAACAGG - Intronic
1078372521 11:10761212-10761234 CTAAGGTAGTGGTTCTCAACTGG - Intronic
1078491702 11:11775436-11775458 CTAGAACAGTGGTGCTGAAGAGG + Intergenic
1078570015 11:12449626-12449648 CTAGATCAGTAGTTCTCCATGGG + Intronic
1078721629 11:13889880-13889902 CTAAAACAGTGGTTCTTACCTGG - Intergenic
1078727735 11:13946642-13946664 TTAGACCTGGGGTTCTCAACTGG - Intergenic
1079047939 11:17125218-17125240 TTACATCAATGGTTCTCAACTGG + Intronic
1079363372 11:19788317-19788339 TTACTACAGTGGTTCTCAACTGG - Intronic
1079372841 11:19866379-19866401 TTTGATCAGTAGTTCTCCACTGG - Intronic
1079419344 11:20271434-20271456 CTAGGCTAGTGGTTCTCAATGGG + Intergenic
1079435733 11:20447228-20447250 CTAGAACAGTGGTTTTCAATGGG + Intronic
1079650394 11:22921229-22921251 CTGTAGCAGTGATTCTCAACGGG - Intergenic
1079938510 11:26648610-26648632 CTAAAGCAGTGGTTCTAAACTGG - Intronic
1080553345 11:33393421-33393443 TCAGAGCAGTGGTTCTCAAAAGG + Intergenic
1080635142 11:34117280-34117302 CTAAATCAGTGGTTCTCATCTGG + Intronic
1080773672 11:35365834-35365856 CTACATCAGTGGCTCTCTACAGG + Intronic
1080919066 11:36690392-36690414 CTAGACTGGTGGTTCTCAACTGG - Intergenic
1080948594 11:37002963-37002985 CCAGAGCAGTGGTTTTCAATTGG + Intergenic
1080955668 11:37092091-37092113 CTAAATCAGTGCTTCTCCACTGG - Intergenic
1081089116 11:38840328-38840350 CTAGCTCAGTTATTTTCAACTGG - Intergenic
1081102926 11:39027587-39027609 TTAGAGCAATGGTTCTCAATGGG + Intergenic
1081251632 11:40842752-40842774 GTAGAACCGTGGTTCTCAAGTGG + Intronic
1081365357 11:42228497-42228519 CTAGAGCAGCAGTTCTCCACTGG - Intergenic
1081688309 11:45057977-45057999 CTAGAGCAGTGGTTCCCAACTGG - Intergenic
1082036240 11:47647572-47647594 TTAGACTAGTGGTTCTCAACAGG + Intergenic
1082796620 11:57382496-57382518 CTAGATCAGAGATCCTCAACTGG - Intergenic
1083076164 11:60041329-60041351 CTAGATCAGTGAAGCTCACCAGG + Intronic
1083550451 11:63585375-63585397 CTAAGTCACTAGTTCTCAACTGG + Intronic
1083987584 11:66226350-66226372 CTGGAGCAGGGGTTCTCAACTGG + Intronic
1084052685 11:66610864-66610886 TTAGATCAGTGGTTCTCAGTGGG + Intergenic
1084206400 11:67596971-67596993 ACAGATCAGTGGTTCTCGAGAGG + Intergenic
1084477281 11:69396136-69396158 CTAGATTAGAGGGTCTCAGCAGG + Intergenic
1084588050 11:70074645-70074667 TGAGAGCAGTGGTGCTCAACTGG + Intergenic
1084728818 11:71060098-71060120 CTGACACAGTGGTTCTCAACCGG + Intronic
1084815474 11:71643333-71643355 GTAGACCAATGGCTCTCAACTGG - Intergenic
1084854375 11:71972737-71972759 CTAGGACAGTGTTTCTCATCAGG - Intronic
1085373256 11:76031805-76031827 TGAAATCAGTGTTTCTCAACAGG + Intronic
1085867362 11:80310050-80310072 CTACATCAGCGGCTCTCAGCTGG - Intergenic
1085900888 11:80698887-80698909 CTAGCCCAGTGACTCTCAACTGG - Intergenic
1085957382 11:81415633-81415655 CTAGATCTGTGCTTCTCAAAAGG - Intergenic
1086064165 11:82729489-82729511 CTAGCATAGTGGTTCTCAACTGG + Intergenic
1086138894 11:83472467-83472489 CCAGATGAGTGGTCCTCAATGGG - Intronic
1086473129 11:87138874-87138896 CTAGAGCAGTGGTTCTTAATTGG + Intronic
1086496755 11:87411955-87411977 TTAGGGCAGTAGTTCTCAACTGG - Intergenic
1086941593 11:92803806-92803828 CTGGGGCAGTGGTTCTCAACTGG - Intronic
1087009643 11:93501137-93501159 CTAGATCAGTGGTACTCAACAGG + Intronic
1087132244 11:94678358-94678380 CTCTATCAGTAGTTCTTAACAGG - Intergenic
1087321245 11:96661600-96661622 CTAGAGTAGTGATTCTCAACTGG - Intergenic
1087802316 11:102517662-102517684 TTAGCTCAGTGGTTCTCAACTGG + Intergenic
1088135356 11:106550682-106550704 CTATAGCAGTGGTTTTCAAGTGG + Intergenic
1088328442 11:108626008-108626030 CTAGAGTGGTGGTTCTCAATTGG + Intergenic
1088790151 11:113217784-113217806 GCAGCTCAGTGCTTCTCAACAGG + Intronic
1090888545 11:130901254-130901276 CTACACTAGTGGTTGTCAACTGG - Intronic
1091245250 11:134088026-134088048 TTACAGCAGTGGTTCCCAACTGG - Intronic
1091480832 12:828653-828675 TTAGATAAGTGATTCTCAACAGG - Intronic
1091610301 12:2001917-2001939 TTAGACCAGTGGCTCTCAGCTGG - Intronic
1091864475 12:3819559-3819581 TTAAAGCAGTGGTTCTCAACTGG - Intronic
1092192630 12:6532189-6532211 CCAGATCAGTGCTTCTGAACCGG + Intergenic
1092424722 12:8365634-8365656 TTAGAGCAGTGGTCCTCAAATGG - Intergenic
1092427537 12:8386721-8386743 GTAGACCAATGGCTCTCAACTGG + Intergenic
1092428802 12:8393697-8393719 GTAGACCAATGGCTCTCAACTGG + Intergenic
1092468761 12:8759728-8759750 CTAAAGCAGTGGTTCTCAACTGG - Intronic
1092510791 12:9154159-9154181 CTGGAACATTGGTTCCCAACTGG + Intronic
1092815266 12:12306988-12307010 CTAGAGCAGTGCTTCTCAAATGG - Intergenic
1093131967 12:15402537-15402559 TTAGATCAGTGCTTCCCATCTGG + Intronic
1093146465 12:15572778-15572800 CTAGATCAATGGTTCTCAACTGG + Intronic
1093197894 12:16150330-16150352 CTAGGTCAATGATTCTCAAGAGG - Intergenic
1093445296 12:19250123-19250145 CTAGACAAGTGGTTCTCAATTGG - Intronic
1093560949 12:20539113-20539135 TTAGATAAGGGATTCTCAACCGG - Intronic
1093670734 12:21871842-21871864 ATAGACCAGTGGTTCTCAAACGG - Intronic
1093987615 12:25554540-25554562 CTAATTTAGTGGTTTTCAACAGG + Intronic
1094094862 12:26692214-26692236 ATAGACCGGTGGTTCTCAACAGG + Intronic
1094113106 12:26882330-26882352 CAATACCAGTGATTCTCAACAGG + Intergenic
1094125668 12:27020464-27020486 CTAGACCAGTGGTTCTCAATTGG + Intergenic
1094670849 12:32567364-32567386 CTAGGTGAGTAGTTCTCAAGCGG + Intronic
1095189533 12:39240681-39240703 GCAGATCAGTGATTCTCAAAGGG - Intergenic
1095401433 12:41818699-41818721 CTAAAGGAGTGGTTCTCAACTGG + Intergenic
1095426365 12:42078455-42078477 CTAGGTCAGTGGTTCTCACCTGG - Intergenic
1095560272 12:43555792-43555814 CTAGAGCAGAGGTTTTCAACTGG - Intergenic
1095660451 12:44727137-44727159 ATAGATCAGTAATTATCAACTGG + Intronic
1095770589 12:45951971-45951993 CTATACTAGTAGTTCTCAACCGG - Intronic
1095799990 12:46261809-46261831 TTAAAGAAGTGGTTCTCAACTGG + Intronic
1096056993 12:48661908-48661930 TTAGAGTAGTGGTTTTCAACTGG - Intronic
1096369725 12:51058877-51058899 TTAGACCAGTACTTCTCAACGGG - Intronic
1096890544 12:54766451-54766473 CTAGACCAATGGTTCTCAACTGG + Intergenic
1096970299 12:55660056-55660078 TTGGATCATTGGTTCTCAACTGG - Intergenic
1097050894 12:56222417-56222439 TTAGATCTGGGGTGCTCAACGGG + Intronic
1097861748 12:64524639-64524661 AAAAGTCAGTGGTTCTCAACTGG - Intergenic
1098222413 12:68284358-68284380 TTGGAGAAGTGGTTCTCAACTGG + Intronic
1098240319 12:68460563-68460585 AAAGAACAGTGATTCTCAACTGG - Intergenic
1098552020 12:71773258-71773280 GTATATCATTGGTTCTCTACCGG + Intronic
1098598644 12:72303003-72303025 CAAGCATAGTGGTTCTCAACGGG - Intronic
1098928591 12:76382544-76382566 CTAAAGCAGTGGTTCTCCTCAGG - Intronic
1098989869 12:77053564-77053586 CTTGGGCAGTGGTTCTCAAAAGG - Intronic
1099029331 12:77505812-77505834 CTAGTGCAGTGGTTTTCAATTGG + Intergenic
1099070019 12:78034302-78034324 TGAGATTAGTGGTTTTCAACTGG - Intronic
1099202711 12:79693621-79693643 CTAACTCAGAGGTGCTCAACCGG - Intergenic
1099673483 12:85726273-85726295 ATAGATTAGTAGTTCTCAAGTGG - Intergenic
1099803371 12:87484803-87484825 ATGAATCAATGGTTCTCAACTGG - Intergenic
1100001996 12:89848484-89848506 TTAGAGCAGTGATTCTCAATGGG - Intergenic
1100277295 12:93082714-93082736 ATAGTTCTGTGGTTCTCCACTGG - Intergenic
1100296116 12:93263251-93263273 CTAGGGCAGTGGTTTTCAACTGG + Intergenic
1100477532 12:94948411-94948433 CTAGCTCAGTGGCTCTCAGCTGG - Intronic
1100675412 12:96861253-96861275 TTAAACCAGTGGTTCTCAATTGG + Intronic
1100686535 12:96992571-96992593 CTAAGCCAGTGGTTCTCACCTGG + Intergenic
1100726981 12:97419062-97419084 CTATACCAGTGGTTCTCAAGAGG + Intergenic
1101017264 12:100514626-100514648 CTCTCTCAGTGATTCTCAACTGG - Intronic
1101040122 12:100747139-100747161 GTAAGTCAGTGGTTCTCAACTGG - Intronic
1101057738 12:100936453-100936475 CTATGTCCGTGGTTCTCAACTGG - Intronic
1101077316 12:101144440-101144462 CCAGATCATTGGTTCTCAAAGGG - Intergenic
1101092762 12:101304583-101304605 CTAATACAGTGCTTCTCAACTGG + Intronic
1101160123 12:101964920-101964942 CTTCATCAGTGATTCTTAACAGG - Intronic
1101238247 12:102811968-102811990 TGAGACCAGTGGTTTTCAACAGG + Intergenic
1101339926 12:103834173-103834195 CTGGAGCAGTGGTTCTCAGTGGG - Intronic
1101347316 12:103898317-103898339 TTAGAGCAGTAGTTCTTAACAGG + Intergenic
1101365523 12:104066069-104066091 CAATATCAGTGGGTCTCAACTGG - Intronic
1101633420 12:106517308-106517330 CTAGTTCAGTGGTTCTAAACTGG - Intronic
1101811260 12:108110005-108110027 TTATATCAGTGCTTCTCAAATGG - Intergenic
1101816732 12:108151387-108151409 CCAAACCAGTGGTTCTTAACTGG - Intronic
1101930478 12:109009715-109009737 CTAGAGCAGTGGTTTTCAACCGG + Intronic
1102118193 12:110419599-110419621 GCAGAGAAGTGGTTCTCAACTGG + Intergenic
1102127474 12:110495921-110495943 TTAGACCAGGGTTTCTCAACTGG - Intronic
1102427330 12:112854256-112854278 CTAGAGCAGTGGTTCTCAACAGG - Intronic
1102545580 12:113652678-113652700 TTAGATCAGTGGTTCTCAACTGG - Intergenic
1102602746 12:114044892-114044914 GTAGACTAGTGGTTCTTAACTGG + Intergenic
1102657933 12:114499003-114499025 CCAGAACAGTGGATCTCAACTGG + Intergenic
1102706720 12:114887521-114887543 TTAGACCAGTGGTTCTCAACTGG + Intergenic
1102725403 12:115060072-115060094 CTAGAACAGAGGTTCTCAATGGG + Intergenic
1102819128 12:115893237-115893259 CTAATCCAGTGGCTCTCAACCGG + Intergenic
1102841626 12:116131146-116131168 CTTCTTCAGTGGTTCTCAACAGG - Intronic
1102894865 12:116590796-116590818 CTACATCAATGCTTCTCACCAGG - Intergenic
1102897437 12:116609931-116609953 TTAGAGCAGTGGTTCTCAACAGG - Intergenic
1102910919 12:116713213-116713235 CTAGGGCAGTGGTGCTCAACAGG - Exonic
1102941497 12:116946601-116946623 TCAGAACAGTGGTTCTCGACTGG - Intronic
1103129864 12:118458762-118458784 GTAGCCCACTGGTTCTCAACAGG + Intergenic
1103143940 12:118577592-118577614 TTAGACCAGTATTTCTCAACTGG + Intergenic
1103173253 12:118840495-118840517 CTAACCTAGTGGTTCTCAACTGG + Intergenic
1103278410 12:119733570-119733592 GTACAGCAGTGGTTCTCAACTGG + Intronic
1103284664 12:119790657-119790679 GCAGACCAGTGGTTCTCAACAGG + Intronic
1103298875 12:119911879-119911901 CTAGCCCAGTGGCTTTCAACTGG - Intergenic
1103308049 12:119981884-119981906 CTAAACCAGTAGTTCTCAACTGG - Intergenic
1103323563 12:120105455-120105477 CGAGCGCAGTGGTTCTCAGCCGG + Intronic
1103855145 12:123962986-123963008 TTGGAGCAGTGGTTCTCAGCTGG + Intronic
1104120463 12:125794052-125794074 TGAGAGCAGTGGTTCTCAACTGG - Intergenic
1104196085 12:126539786-126539808 CTGAACCAGTGGTTCTCAAATGG + Intergenic
1104293556 12:127491210-127491232 TTAAGTCACTGGTTCTCAACTGG - Intergenic
1104336049 12:127896544-127896566 CTAGTTAAGTGTTTCTCAGCTGG + Intergenic
1104426007 12:128678617-128678639 CTAGACCAGTGGTTCTCTGTGGG + Intronic
1104570684 12:129922739-129922761 CTAACAAAGTGGTTCTCAACAGG + Intergenic
1104617674 12:130284033-130284055 TTATGTCAGTGGTTCTCCACTGG - Intergenic
1104617829 12:130285183-130285205 TGATGTCAGTGGTTCTCAACTGG + Intergenic
1104663629 12:130631608-130631630 GTAGATAAGTGGTTCTCAAAGGG - Intronic
1104669681 12:130671781-130671803 TTAAACCAGCGGTTCTCAACCGG - Intronic
1105546979 13:21357926-21357948 CAAGATCAGTGGTTGCCAAGGGG + Intergenic
1105657377 13:22455756-22455778 CTTGGTTAGTGGTTCCCAACTGG - Intergenic
1105891314 13:24684537-24684559 TTAGCCCAGTGGTTCTCAAAGGG + Intronic
1105940439 13:25142692-25142714 ATAGACCAGTGGTCCTCAACTGG + Intergenic
1106272076 13:28164734-28164756 CTAGAGCAGTGTTACTCAAAAGG - Intronic
1106383267 13:29260758-29260780 CTAGAGCAGTGGTTCTTAATCGG + Intronic
1106527878 13:30559181-30559203 CTAAGGCAGTGCTTCTCAACAGG - Intronic
1107494424 13:40911052-40911074 CTAAAGCAGTGGTTCTTAACTGG - Intergenic
1107597356 13:41976729-41976751 CTAAATCACTGATTCTCAACTGG + Intergenic
1107650562 13:42540799-42540821 CTAGACCAGTGGTTCCCAACTGG - Intergenic
1107674977 13:42786189-42786211 CTAGAATACTGGTTCTCAAACGG - Intronic
1107695313 13:42993860-42993882 CTACAACAGTGGTTCCCAAAGGG - Intergenic
1107695379 13:42994458-42994480 CCACATCAGTGGTTCTCAAATGG + Intergenic
1108668778 13:52660259-52660281 CTAAAGAAGTGGTTCTTAACTGG + Intronic
1109350737 13:61177972-61177994 TTAGGGCAGTGGTTCTCAACTGG + Intergenic
1109817814 13:67609588-67609610 TAATATCAGTAGTTCTCAACTGG - Intergenic
1109968984 13:69739795-69739817 TTAGATCTGTGGTTCTCATGGGG + Intronic
1110237765 13:73234308-73234330 TTAGGCCAGTAGTTCTCAACAGG + Intergenic
1110415806 13:75250946-75250968 CTAGTCCAGCGGTTCTAAACTGG - Intergenic
1110462689 13:75763116-75763138 TTAGATCAGTGGTTCTCAACTGG + Intronic
1110483517 13:76011769-76011791 TAAGATCAGTGGTTCTTAGCTGG + Intergenic
1110556964 13:76870557-76870579 ATAGAGCAGTGCTTCTCAAATGG - Intergenic
1111485382 13:88891681-88891703 ATAGATCAGTATTTCTTAACAGG - Intergenic
1111650203 13:91080945-91080967 TTAGGGCAGTGGTTCTCAATGGG - Intergenic
1111664441 13:91249370-91249392 CTAGATCAGGGTTTCTTAACTGG + Intergenic
1111874232 13:93873441-93873463 ATAGAGCAATGGTTCTCAACTGG + Intronic
1111901534 13:94205866-94205888 CTGGAACACTGGTTTTCAACTGG + Intronic
1112240282 13:97674494-97674516 CTAGATCCCTGGTTCACAAATGG + Intergenic
1112273352 13:97991985-97992007 CTAACTCAGTGGTTCTCAAGAGG - Intronic
1112514349 13:100039135-100039157 CTAGATTAGTGCTTCTCAACTGG + Intergenic
1112614581 13:100990322-100990344 CTAGACCAGTGATTCTCAATGGG + Intergenic
1112718506 13:102214682-102214704 CTAGATCAGGGGATCTCAACCGG + Intronic
1112721892 13:102254810-102254832 CTATGTCAGTGGTTCCCAACTGG - Intronic
1112757374 13:102652736-102652758 AAAGATCAGTATTTCTCAACTGG + Intronic
1112827725 13:103411352-103411374 CTAGAACAATGGTTCTCAACTGG - Intergenic
1113031867 13:106001968-106001990 CTAGAAAAGTGGTTCTCAACTGG - Intergenic
1113136575 13:107096802-107096824 TTATATCAGTGGTTGTCAACTGG - Intergenic
1113232121 13:108223777-108223799 CTATGCCAGTGGTTCTCAAAAGG - Intronic
1113382250 13:109814429-109814451 TTAGCACAGTGGTTCTCAATTGG + Intergenic
1113532177 13:111036098-111036120 TTAGAGCAGTGGTTCTTAACTGG - Intergenic
1114141625 14:19918010-19918032 GTAGCACAGTGGTTCTCAACTGG + Intergenic
1114315155 14:21503064-21503086 TTACAGCAGTGGTTCTCAACTGG - Intronic
1114664847 14:24371504-24371526 CTAGGACAGTGGATCTCAACTGG - Intronic
1114874564 14:26699830-26699852 ACAGAAGAGTGGTTCTCAACTGG + Intergenic
1114990459 14:28280618-28280640 TTAGAATAGTGGTTTTCAACTGG + Intergenic
1114999328 14:28402086-28402108 TTATATCAGTAGTTCTCAGCTGG + Intergenic
1115030598 14:28788696-28788718 CAATTGCAGTGGTTCTCAACTGG + Intronic
1115053166 14:29089702-29089724 CTGGAGCACTGGTTCTCCACTGG - Intergenic
1115177519 14:30580913-30580935 TAAGATCAGTAGTTCTCAACTGG - Intronic
1115261513 14:31459169-31459191 GTAAGACAGTGGTTCTCAACTGG + Intergenic
1115376509 14:32682797-32682819 CTGAAGCAATGGTTCTCAACTGG - Intronic
1115788733 14:36855840-36855862 TTAACCCAGTGGTTCTCAACAGG + Intronic
1115855563 14:37626132-37626154 TTAGGTCAGTGGTTCTCAATTGG - Intronic
1116283344 14:42939374-42939396 TTAGACCAGTTGTTCTTAACAGG + Intergenic
1116572759 14:46538641-46538663 TTACTCCAGTGGTTCTCAACAGG - Intergenic
1116604572 14:46973451-46973473 CCAGGTCAGTGTTTCTCAAAGGG - Intronic
1116672943 14:47866918-47866940 CTATCTCAGTGGGTCTCAAATGG + Intergenic
1116971338 14:51069291-51069313 CTAGACCACTGGTTCTCATCTGG + Intronic
1117126401 14:52631551-52631573 CCAACTTAGTGGTTCTCAACTGG - Intronic
1117383708 14:55191132-55191154 CTTGACTAGAGGTTCTCAACCGG + Intronic
1117520247 14:56544418-56544440 CTCAATCAGTGGTTATCAACTGG - Intronic
1117710525 14:58524523-58524545 CTTAATCAGTGTTTCTCAAAGGG - Intronic
1118108824 14:62693276-62693298 GTAGATCAGTAGTTCTCAACTGG - Intergenic
1118277179 14:64395610-64395632 TTAGATCAGAGGTTGTCAAATGG + Intronic
1118449303 14:65884371-65884393 CTAGATCATTAATTCTCAACTGG - Intergenic
1118695649 14:68382353-68382375 TGAGATCAGTGATTCTCATCCGG - Intronic
1118799575 14:69177335-69177357 GTGGAGCTGTGGTTCTCAACTGG + Intergenic
1119008305 14:70955966-70955988 CTAAATCATTATTTCTCAACTGG + Intronic
1119157947 14:72428825-72428847 CTAAGTCAGTGGTTGTCAACTGG + Intronic
1119268713 14:73281977-73281999 TTAGTGTAGTGGTTCTCAACTGG - Intronic
1119555984 14:75552985-75553007 CTAGCTCAGTGGTTCCTAACTGG + Intergenic
1119712131 14:76829929-76829951 CCACAACAGTGGTTCTCACCTGG + Intronic
1119955089 14:78789319-78789341 CTAGTTAAGGGGTTCTCAACTGG + Intronic
1120204831 14:81576684-81576706 ATGGAGCAGTGGTTCTCAAAAGG - Intergenic
1120374727 14:83688873-83688895 CTAGAACAGTGGTTCTAGATTGG + Intergenic
1120386483 14:83853046-83853068 CTATAACTGTAGTTCTCAACTGG + Intergenic
1120623812 14:86799395-86799417 CTATAGCAGTGGATCTCAACTGG + Intergenic
1120699302 14:87680717-87680739 ATAGATTAGTGGCTCTCAACTGG - Intergenic
1120701907 14:87707296-87707318 CTAAATCAGTAGTACTCAAATGG + Intergenic
1120909574 14:89653810-89653832 CTAGGGCAGTGGTTCTCAAATGG - Intergenic
1120926584 14:89803144-89803166 CTGGCTCAATGGTTGTCAACTGG - Intronic
1121291634 14:92780384-92780406 TTAGCTCAGTGGTTCTCAACTGG + Intergenic
1121787484 14:96673380-96673402 CTGGAGCTGTAGTTCTCAACTGG + Intergenic
1122008697 14:98728008-98728030 CTAGGGCAGAAGTTCTCAACTGG + Intergenic
1122042526 14:98999115-98999137 CTAGAGCAGTGATTCTCTCCAGG - Intergenic
1122187133 14:100008082-100008104 CTACACCAGCAGTTCTCAACTGG - Intronic
1122332337 14:100930713-100930735 GTACCTCAGTGGTTCTCAACTGG - Intergenic
1122393230 14:101404889-101404911 TTAGACCAGGGTTTCTCAACAGG - Intergenic
1122572532 14:102716026-102716048 GTAGAGCAGTGGTTCTCAAATGG - Intronic
1124175090 15:27417030-27417052 CTAGAGCAGTGGTTCTTAGCTGG + Intronic
1124339057 15:28878158-28878180 GTATGTCAGTGGCTCTCAACTGG - Intergenic
1124366526 15:29075550-29075572 TTAGAACAGTGGTTCTCAACTGG - Intronic
1124434839 15:29638432-29638454 GTAAAACAGTGGTTCTCAGCTGG - Intergenic
1124576395 15:30912678-30912700 CTAGCCAAGTGGTTCTCAACTGG + Intronic
1125424647 15:39536619-39536641 CTACATCAGTGTCTCTCAAATGG - Intergenic
1125431809 15:39602938-39602960 CTAGAACAACGGTCCTCAACTGG + Intronic
1125682517 15:41541049-41541071 CTGGTTCAGTGGTTTTCAACTGG - Intronic
1125768141 15:42148614-42148636 TTAGCTCGGTGGTGCTCAACGGG - Intronic
1125895034 15:43294696-43294718 TTATCTCAGTGGTTCTCAACGGG + Intronic
1126080479 15:44956616-44956638 CTCGATGATTGGTTCTCAAGAGG - Intergenic
1126376996 15:48006809-48006831 CTAAAGTAATGGTTCTCAACTGG + Intergenic
1126417607 15:48434040-48434062 CTAGAGCAGTGGCTCTCAAAGGG - Intronic
1126465049 15:48954293-48954315 TCAGAGCAATGGTTCTCAACGGG - Intronic
1127135038 15:55911127-55911149 CTACAGCAGTGACTCTCAACAGG + Intronic
1127284243 15:57518648-57518670 CTAGACCAGCGATTCTCAACTGG + Intronic
1127323013 15:57865874-57865896 TTAGATCAGAGGTTCTCAAATGG - Intergenic
1127381436 15:58434001-58434023 CTACACCAATGGTTCTCAACAGG + Intronic
1127521032 15:59743164-59743186 CTAAGGCAGTGGGTCTCAACTGG + Intergenic
1127604026 15:60568110-60568132 ATAAAACAGTGGTTCTCAACTGG - Intronic
1128084491 15:64876476-64876498 CTAGAGCAGTGTTTTTCAAATGG + Intronic
1128390435 15:67179241-67179263 CTAGGGCAATGGTTTTCAACTGG + Intronic
1128394889 15:67214568-67214590 CTATGTCAGTGGTTCTCAATTGG - Intronic
1128397531 15:67243432-67243454 CTAAAGCAGTGGTTCTCTATGGG + Intronic
1128570203 15:68728143-68728165 GTAGAACAGTGGTTCTTAACCGG - Intergenic
1128645880 15:69378737-69378759 CTAAATCAGTGGTCCTTACCTGG + Intronic
1128684930 15:69676967-69676989 GTAGACTAGTGGTTTTCAACTGG + Intergenic
1128766944 15:70256999-70257021 CTAGACCAGCGGTTCTCAACTGG - Intergenic
1128795103 15:70460796-70460818 CTAAATCAGTGTTTTTCAGCTGG - Intergenic
1129033207 15:72633069-72633091 TTAGGTCAGCAGTTCTCAACTGG - Intergenic
1129042161 15:72697566-72697588 CCAGAGCAGTGGTTCTCAAGTGG - Intronic
1129050171 15:72774539-72774561 GCAGACCAGTGGTTCTCAAAAGG + Intronic
1129088915 15:73127586-73127608 GTAGAACAATGGTCCTCAACTGG - Intronic
1129216677 15:74104161-74104183 TTAGGTCAGCAGTTCTCAACTGG + Intronic
1129297326 15:74606862-74606884 CTAAATCAGTGTATCTCAAATGG - Intronic
1129362846 15:75035182-75035204 GTAGAGTTGTGGTTCTCAACGGG + Intronic
1129407997 15:75331924-75331946 TTAGGTCAGCAGTTCTCAACTGG - Intergenic
1129471161 15:75754703-75754725 TTAGGTCAGCAGTTCTCAACTGG - Intergenic
1129733843 15:77948474-77948496 TTAGGTCAGCAGTTCTCAACTGG + Intergenic
1129799567 15:78403815-78403837 ATAATGCAGTGGTTCTCAACTGG + Intergenic
1129817826 15:78570984-78571006 CTAGAGAAGTGGTTCTCAAGGGG - Intronic
1129841741 15:78747529-78747551 TTAGGTCAGCAGTTCTCAACTGG - Intergenic
1129854908 15:78816621-78816643 CTAGAACAGTGGTTCTCAAGCGG + Intronic
1129904305 15:79175286-79175308 CTAGAACATTGGGTCTCAGCTGG - Intergenic
1129945794 15:79538529-79538551 CTAGGGCAGTGGTTCTCAACTGG + Intergenic
1130016849 15:80194040-80194062 CTAGAACAGTAATTCTCAAAAGG + Intergenic
1130063646 15:80587433-80587455 TTAGCTCAGTGGTTCCCAATCGG - Intronic
1130204311 15:81861823-81861845 CTATTTTGGTGGTTCTCAACTGG - Intergenic
1130260960 15:82353974-82353996 CTGGATCAGTGTTTCCCAAATGG + Intergenic
1130280275 15:82515042-82515064 CTGGATCAGTGTTTCCCAAATGG - Intergenic
1130350478 15:83086974-83086996 CTAGATCTGCAGTTCTCAAACGG - Intergenic
1130366957 15:83249384-83249406 CTAGACCAGTGATTCTCAACTGG + Intergenic
1130471648 15:84231225-84231247 CTGGATCAGTGTTTCCCAAATGG - Intergenic
1130479142 15:84345796-84345818 CTGGATCAGTGTTTCCCAAATGG - Intergenic
1130492628 15:84442334-84442356 CTGGATCAGTGTTTCCCAAATGG + Intergenic
1130593943 15:85235856-85235878 CTGGATCAGTGTTTCCCAAATGG - Intergenic
1130613110 15:85379384-85379406 CTGGATCAGTGTTTCCCAAATGG + Intergenic
1130835865 15:87649447-87649469 CTAGACCAGTGGTTCTCAACTGG + Intergenic
1130848869 15:87774074-87774096 CTACTTCAGTACTTCTCAACTGG - Intergenic
1131019014 15:89082150-89082172 CTAAACCAGTGGTTCTCAACTGG - Intergenic
1131077686 15:89506089-89506111 ATACCCCAGTGGTTCTCAACTGG - Intergenic
1131123616 15:89839128-89839150 CTGGACCAGTGGTTCTCAGCTGG - Intronic
1131305292 15:91237426-91237448 CTAGTGCAGTGGTTGTCAACTGG - Intronic
1131421726 15:92311980-92312002 CTAGTCCAGTGGTTCTTAACTGG + Intergenic
1131442841 15:92471783-92471805 CTGGGTCAGTGGTTCCCAGCTGG - Exonic
1131548545 15:93336360-93336382 TTAGATCAGTGGCTCTCAACTGG + Intergenic
1131639062 15:94270233-94270255 CTATCTCAGTGTTGCTCAACAGG - Intronic
1131753744 15:95538194-95538216 TTCAATCAGTGGTTTTCAACTGG + Intergenic
1132075814 15:98818835-98818857 CTGGTCCAGTGGTTCTCAACAGG - Intronic
1132180096 15:99745765-99745787 TTAGAGCAGTGGTTCCTAACGGG + Intergenic
1132277447 15:100581420-100581442 TTAGCTCAGTGGTTCTCAACTGG - Intronic
1133370710 16:5243659-5243681 GTAGACCAATGGCTCTCAACTGG - Intergenic
1133406759 16:5530756-5530778 CTAGAGCAGTGCTTCTCAACTGG - Intergenic
1133474817 16:6110706-6110728 CCAGAGCAGTGGTTCTCAATGGG + Intronic
1133522990 16:6576925-6576947 CTAGATGGGTGGTTCTTTACAGG - Intronic
1133608192 16:7408872-7408894 CTAGAACAATGGTTCTTATCTGG - Intronic
1133661199 16:7919522-7919544 CTAGACCAGTGGTTCTCAACTGG - Intergenic
1133703276 16:8329282-8329304 TTAAACCAGTGGTTCCCAACTGG - Intergenic
1133742802 16:8664019-8664041 CTAGCCCAGTGGTTATTAACTGG - Intergenic
1133882695 16:9797935-9797957 CTAGGGCAGTGGTTCTCAAAGGG - Intronic
1133908818 16:10046064-10046086 TTAGAGCAGTGGTTTTCAACTGG - Intronic
1133917155 16:10119541-10119563 CTAGCCCCGTGGTTCTCAACAGG + Intronic
1133997212 16:10757613-10757635 GTAAGTCAGTGGCTCTCAACTGG - Intronic
1134112194 16:11522565-11522587 GTAGATGAATGCTTCTCAACTGG - Intronic
1134135398 16:11673662-11673684 CTTGTTCAGTGGTTCTCAACTGG - Intronic
1134136567 16:11680335-11680357 CTAAGGCAGGGGTTCTCAACTGG + Intronic
1134145499 16:11757520-11757542 TTAGCACAGTGGTTCTCAACTGG - Intronic
1134291701 16:12906926-12906948 CTAAGTTAGTGGTTCTCAACTGG - Intronic
1134315890 16:13118502-13118524 CTAGAACAGTGCTTCCCAAAAGG + Intronic
1134322087 16:13173526-13173548 CTAGATCAGCAGTTCTTAACTGG + Intronic
1134360353 16:13525201-13525223 TTAGCTCAGTGGTTCTCAAAGGG - Intergenic
1134372791 16:13641112-13641134 CTAGACCAATGGTTCTCAACTGG + Intergenic
1134380187 16:13717097-13717119 CTAAACCAGTGGTTCTCAACTGG + Intergenic
1134394204 16:13848146-13848168 CTACAACAGTAGTTCTCAATTGG - Intergenic
1134416646 16:14048986-14049008 CTATATCAGTGGCTCTTAGCTGG + Intergenic
1134559975 16:15200199-15200221 TTAAACCAGTGGTTCTCAATAGG - Intergenic
1134567403 16:15263371-15263393 CTACAACACTGGTTCTCAACTGG - Intergenic
1134643560 16:15848727-15848749 CTAAAGCTGTGGTTCTCAACTGG - Intronic
1134735089 16:16493329-16493351 CTACAACACTGGTTCTCAACTGG + Intergenic
1134816739 16:17212047-17212069 CTAGAACAGTGGTTCTCAACTGG - Intronic
1134819065 16:17230791-17230813 CTAACTCAGTGGCCCTCAACTGG + Intronic
1134830865 16:17321674-17321696 TTAGAGCAGTGGTTCTCAATCGG + Intronic
1134920515 16:18111808-18111830 TTAAACCAGTGGTTCTCAATAGG - Intergenic
1134932432 16:18218888-18218910 CTACGACACTGGTTCTCAACTGG - Intergenic
1135028120 16:19014364-19014386 TTAGATCAGTGGTTCTCAAGTGG - Intronic
1135029305 16:19025234-19025256 CTAGAGCAGTGGTTCTCATCTGG - Intronic
1135052512 16:19204282-19204304 TCAAATCAGTGGTTCTCAAGGGG - Intronic
1135078643 16:19415333-19415355 TTAGAGCAGTGGTTCTCAGGGGG + Intronic
1135080237 16:19427814-19427836 CTAGAGCAGTGGTTCTCAAGTGG - Intronic
1135142431 16:19933121-19933143 ATATAGCAGTGGTTCTCGACTGG + Intergenic
1135187166 16:20325016-20325038 TTAGATCAGTGGTTCTCAACTGG - Intronic
1135210490 16:20521785-20521807 CTAGACCAGTGGGTCTCACCTGG - Intergenic
1135271923 16:21077074-21077096 TTACAACAGTGGTTCTCAACTGG - Intronic
1135285231 16:21187572-21187594 CTAGATCAGCAGTTCTCAGTTGG + Intergenic
1135422388 16:22313934-22313956 CTAAGCCAGTGGTTCTCAATCGG - Intronic
1135464883 16:22676688-22676710 CTAATTCAGTGGTTCTCAGTCGG - Intergenic
1135549386 16:23386506-23386528 CTAAGCCAGTGTTTCTCAACTGG + Intergenic
1135597819 16:23756649-23756671 ATAGATCAGTGATTCTCAACTGG + Intronic
1135740930 16:24974564-24974586 TTGGCTCAGTGGTTCTTAACAGG - Intronic
1135885763 16:26305766-26305788 CTAGAGCAGTGGTTCTCAAACGG - Intergenic
1136106660 16:28034879-28034901 CTAGTATAGGGGTTCTCAACTGG - Intronic
1137294050 16:47073333-47073355 CTATAGCAGTGGTTCTCAACTGG + Intergenic
1137306437 16:47205373-47205395 TTGGACCAGTGGTTCTCAATCGG - Intronic
1137435403 16:48450840-48450862 CCACATCAGTGGTTCTCACTGGG - Intergenic
1137645446 16:50069457-50069479 TTAGAGCAGTGATTCTCAACTGG + Intronic
1137752997 16:50880435-50880457 CTAAAGCAGTGGCTCCCAACTGG - Intergenic
1137763123 16:50956617-50956639 CTACAGCAGTGGTTCTCAACTGG - Intergenic
1137783842 16:51121095-51121117 TCAGAGTAGTGGTTCTCAACTGG - Intergenic
1137817899 16:51416556-51416578 CTAGAGAAGTGGCTCTCAACCGG - Intergenic
1137864355 16:51877750-51877772 TTAGGGCAGTGGTTCTCAATTGG + Intergenic
1137917807 16:52452068-52452090 GTAGGTTAGTGGTTCTCAACTGG - Intronic
1138090349 16:54168705-54168727 CTAGAGCAGTGGTTCTCAACAGG + Intergenic
1138197178 16:55060330-55060352 CTAGCCCAGTGGTTCTCAACAGG + Intergenic
1138344922 16:56314840-56314862 CTAGATCAGCGGTTCTCAAAGGG - Intronic
1138745222 16:59355470-59355492 TTAAGCCAGTGGTTCTCAACTGG + Intergenic
1138928620 16:61623510-61623532 TTACACCATTGGTTCTCAACTGG - Intergenic
1138977584 16:62226422-62226444 CTATGTTAGTTGTTCTCAACAGG - Intergenic
1139019251 16:62726617-62726639 CTAGATCCCTGCTTCTCAACTGG - Intergenic
1139034293 16:62924634-62924656 CTGGTTCAGTGGCTCTCAACTGG + Intergenic
1139137355 16:64220930-64220952 ATACATCAGTTGTTCTCAACTGG - Intergenic
1139223072 16:65204547-65204569 CTAAATCAGTGTTTCTCCATGGG + Intergenic
1139343929 16:66289918-66289940 CTGACCCAGTGGTTCTCAACTGG + Intergenic
1139553513 16:67690607-67690629 ATAGTTCAGAGGTTCTCAGCTGG - Intronic
1139557324 16:67720517-67720539 CTAGACTAGTGGTTCTCAACTGG - Intergenic
1139646170 16:68332394-68332416 TTAGAGCAGTGGTTCTCAACAGG - Intronic
1139892885 16:70265403-70265425 CTAGATCAGTGGTTCTCAAGTGG - Intronic
1140040005 16:71400773-71400795 GTAGATCAGGGGTTGTCAAGGGG + Intergenic
1140058022 16:71542845-71542867 CTACATGAGTGGTTCTCAACTGG + Intronic
1140226770 16:73083939-73083961 CTAGGGCCATGGTTCTCAACTGG + Intergenic
1140251889 16:73301586-73301608 CTAGGCCAGTGGTTCTCAACTGG - Intergenic
1140304610 16:73791312-73791334 ATAGATCAGTAGTTCTCAAACGG + Intergenic
1140580612 16:76226859-76226881 TTAAGTCAGTGGTTCTCACCAGG - Intergenic
1140734201 16:77883688-77883710 CTGAATCAATGGTTCTGAACTGG - Intronic
1140930354 16:79622073-79622095 GTAGAGCAGTGGTTCTCAACTGG - Intergenic
1140933495 16:79649894-79649916 CTCCAGCAGTGGTTCTCAATTGG + Intergenic
1140986651 16:80164304-80164326 TTAAGGCAGTGGTTCTCAACTGG + Intergenic
1141016041 16:80450444-80450466 TGAGATCGATGGTTCTCAACTGG - Intergenic
1141065244 16:80908749-80908771 ATAGCTCAGTTGTTCTCAACAGG - Intergenic
1141148572 16:81548899-81548921 GTAAAGCAGTGGTTCCCAACGGG - Intronic
1141222525 16:82084393-82084415 CAAGATCAGAGGTTTTCAACTGG - Intronic
1141229381 16:82150543-82150565 CTAGAGAAGTGGTTCTTAACTGG + Intronic
1141268231 16:82516360-82516382 CTAGAACAATGATTTTCAACTGG + Intergenic
1141271596 16:82545893-82545915 CTAGGCCAGTGGCTCTCAACTGG + Intergenic
1141284612 16:82659958-82659980 CTAAAGCAGTGGTTCTCAATGGG - Intronic
1141338323 16:83178359-83178381 CTAAATCAGTGGTTCTCAACTGG - Intronic
1141377311 16:83543607-83543629 CTAAGTCAGTGGTTCTCAACTGG + Intronic
1141522744 16:84592137-84592159 TTACAGCAGAGGTTCTCAACTGG - Intronic
1141737113 16:85861121-85861143 CTAATTCAGTAGTTCTCAACAGG + Intergenic
1141807240 16:86349780-86349802 TTAAACCAGTGGTTCTCAAAAGG - Intergenic
1141969155 16:87468657-87468679 CTAACCTAGTGGTTCTCAACTGG + Intronic
1142574613 17:898283-898305 CTAGGAAAGTGGTTCTCAACTGG - Intronic
1142891439 17:2946671-2946693 ATAGGTCAGTGGTTCTCACTTGG + Intronic
1142965701 17:3579820-3579842 CTAAAGCGGTGGTTCTCAACCGG + Intronic
1143590029 17:7879119-7879141 ATAAATCAGTGGTTCTCAAATGG - Intronic
1143691029 17:8566171-8566193 CTAGGTCAGTGGTTCTTAATTGG - Intronic
1143705087 17:8691898-8691920 CAAGGTCAGTGGTTCTCAGCTGG + Intergenic
1143832007 17:9660046-9660068 CTAGAGCAGTAGCTCTCAACTGG - Intronic
1144068762 17:11647807-11647829 CTAGATTAGTGGTTCTCAACTGG + Intronic
1144374998 17:14630394-14630416 ATATTTCAGTGGTTCTCAAATGG + Intergenic
1144465628 17:15494750-15494772 CTAAGCCAGTGCTTCTCAACAGG + Intronic
1145053594 17:19683166-19683188 CTGGACCAGTGTTTCTCAAATGG + Intronic
1145103755 17:20097998-20098020 CTAGAACAATGGTTCTCAATGGG - Intronic
1146177093 17:30672579-30672601 AGAGAGCAGTGGTTCTCAACTGG - Intergenic
1146222744 17:31039093-31039115 AGAGAGCAGTGGTTCTCAACTGG - Intergenic
1146309764 17:31758660-31758682 TTAGATTGGTGGTTCTCAATGGG - Intergenic
1146342251 17:32030917-32030939 AGAGAGCAGTGGTTCTCAACTGG + Intronic
1146350557 17:32088679-32088701 AGAGAGCAGTGGTTCTCAACTGG - Intergenic
1146363008 17:32194561-32194583 GGGAATCAGTGGTTCTCAACTGG - Intronic
1146441226 17:32896874-32896896 CTAGAGCAGGGGTTCTCCACTGG - Intergenic
1146640577 17:34537773-34537795 CTACATTAATGGTTCTCAACTGG + Intergenic
1146683170 17:34823093-34823115 CTAGAGCAATGATTCTCAGCCGG - Intergenic
1146803880 17:35849692-35849714 CTAAGGCAGTGGTTCTCAACAGG - Intronic
1147175536 17:38654014-38654036 CTTGAGCAGTGGTTCTTAACTGG - Intergenic
1147558030 17:41491911-41491933 ATAGTCCAATGGTTCTCAACTGG - Intronic
1148042185 17:44716697-44716719 CTAGAGCCGTGGTTCTTAACTGG - Intronic
1148179610 17:45594729-45594751 TTAGTCCCGTGGTTCTCAACTGG - Intergenic
1148269296 17:46251169-46251191 TTAGTCCCGTGGTTCTCAACTGG + Intergenic
1148362856 17:47027815-47027837 AGAGAGCAGTGGTTCTCAGCTGG + Intronic
1148394412 17:47296583-47296605 TTAAAACGGTGGTTCTCAACTGG + Intronic
1148495741 17:48052666-48052688 CTAGGCCAGTGGTCCTCAACTGG + Intronic
1148541893 17:48487577-48487599 CTAAGTCAGTAGTTCTCAACAGG - Intergenic
1148601579 17:48898420-48898442 GTAGACCAGTAGCTCTCAACTGG - Intergenic
1148823674 17:50376614-50376636 CTATGCCAATGGTTCTCAACCGG - Intronic
1149056376 17:52371366-52371388 TTATACCAGTGGTTCTCAATTGG - Intergenic
1149063068 17:52446946-52446968 CTAGCACAGTATTTCTCAACTGG + Intergenic
1149207764 17:54268184-54268206 CTAGCCCAGTGGCTCTCAACTGG + Intergenic
1149297122 17:55271097-55271119 CTAGACCAGTGGTTCTCCACCGG - Intronic
1149607138 17:57933066-57933088 CTAGTGCAGTGGTTCACAAGTGG - Intronic
1149689804 17:58565884-58565906 CTAGAGCAGTGGTTCTCCAAGGG + Intronic
1150234730 17:63583771-63583793 CTAGAAGGCTGGTTCTCAACTGG + Intronic
1150364550 17:64569845-64569867 CTAGAGCAGTGTTACTCAAAGGG + Intronic
1150673840 17:67226957-67226979 CAAGATCAGTGGTTGTGAGCAGG + Intronic
1150837474 17:68577418-68577440 GTAGACCAGTGGTTCGCCACTGG + Intronic
1150913144 17:69410101-69410123 GAATATCAGTGTTTCTCAACTGG - Intergenic
1150933387 17:69609789-69609811 ATAAATCAGTGGTCCTCGACAGG - Intergenic
1151075858 17:71271855-71271877 CTAGTGCAGTGGTTCTCAGCTGG + Intergenic
1151083029 17:71350321-71350343 GCAGTTCAGTGGTTCTCAAATGG + Intergenic
1151124701 17:71832226-71832248 CTAAACTACTGGTTCTCAACTGG + Intergenic
1151169636 17:72235894-72235916 GTAGAACAGTGGTTCTCAACTGG - Intergenic
1151185751 17:72362778-72362800 CTAAATCAGTGGTTCTCAACTGG + Intergenic
1151189657 17:72388901-72388923 ATAAACCAGTGGTTCTCAAGTGG - Intergenic
1151327592 17:73388676-73388698 TTAGTACAGTGCTTCTCAACTGG - Intronic
1151470800 17:74316554-74316576 CTAGAGCAGCGATTCTCTACTGG + Intergenic
1152235732 17:79137430-79137452 CTGGGTCAGTGATTCTCAACAGG - Intronic
1152391830 17:80008082-80008104 CTAGAGCAGTGATTCTCACCCGG - Intronic
1153426549 18:4971353-4971375 CTAAAGCAGTTGTTTTCAACTGG + Intergenic
1153674766 18:7447070-7447092 GAAGCTCAATGGTTCTCAACTGG - Intergenic
1153860121 18:9194300-9194322 CTATATCAGTAGTTCTCAAATGG - Intronic
1153995238 18:10434561-10434583 CTAGGACAGTGGTTCTCCAAGGG + Intergenic
1154240867 18:12653060-12653082 CTAGAGCAGTGGTTCTCAACTGG + Intronic
1154939897 18:21101584-21101606 CTAGGTCAGTGGTACTATACAGG - Intronic
1154958681 18:21285960-21285982 TTAGAGCAGTGCTTCTCAAATGG + Intronic
1154962356 18:21322290-21322312 CTAGATTAGTGATTCTCAACTGG + Intronic
1155176058 18:23302337-23302359 TTAGACCAGTGATTCTCAACTGG + Intronic
1155273688 18:24165763-24165785 CCAACTCAGTGGTTCTCAAAAGG - Intronic
1155542000 18:26878475-26878497 TTAGATCAGTGGGTCTCAAAGGG - Intergenic
1156040783 18:32819869-32819891 ATAAGTCAGTGGTTCTTAACAGG + Intergenic
1156364038 18:36409062-36409084 CTGGACCAGTGCTTCTCACCGGG + Intronic
1156541764 18:37919026-37919048 CTACATCACTAGTTCTCAATGGG - Intergenic
1156964239 18:43071341-43071363 CTACATCCCAGGTTCTCAACTGG + Intronic
1157176377 18:45456210-45456232 CTAGCCCTGTGGTTCTGAACAGG - Intronic
1157367830 18:47082391-47082413 TTAGTCCAGTGGTCCTCAACTGG - Intronic
1157395825 18:47340051-47340073 CTGGAGCAGTGGTTCTCACCAGG + Intergenic
1157545492 18:48543563-48543585 CCAGAGCTGTGGTTCACAACGGG + Intronic
1157686525 18:49646977-49646999 GTAGAGCAGTTGTTCTCAACTGG - Intergenic
1157753219 18:50195977-50195999 CCTGAAAAGTGGTTCTCAACCGG + Intergenic
1157796269 18:50578477-50578499 CTAGACCAGTGGTTCTCAAATGG - Intronic
1158011213 18:52730140-52730162 AGAGGGCAGTGGTTCTCAACTGG + Intronic
1158068410 18:53441128-53441150 CTAGCTCAGTGGTTTCCAACTGG - Intronic
1158163206 18:54508932-54508954 TGAAACCAGTGGTTCTCAACTGG - Intergenic
1158212640 18:55068199-55068221 ATAAATAAGTGGTTCTCAGCTGG - Intergenic
1158953634 18:62520670-62520692 CTAGAGCAGGTGTTCTCAACAGG + Intergenic
1159103371 18:63979433-63979455 CTAGACTAGTGGTTCTCACCTGG + Intronic
1159270428 18:66142149-66142171 CTAGAGCAAAGGTTCTCACCTGG - Intergenic
1159370384 18:67520810-67520832 TTACACCAGTGTTTCTCAACAGG + Intergenic
1159576421 18:70183753-70183775 CTAAAATAGTGGTTTTCAACTGG - Intronic
1159803401 18:72927135-72927157 CTGGGTCAGGGGTTCTCATCCGG - Intergenic
1161143593 19:2664013-2664035 TTAGAGCATTGGGTCTCAACTGG - Intronic
1161305637 19:3565998-3566020 CTAGCTCAGTGGTTCTCATCCGG - Intronic
1161551591 19:4915906-4915928 CCAGGTCAGGGGTTCTCAAACGG + Intronic
1161605262 19:5211348-5211370 TTCTATCAGTGGTTCTCAATTGG - Intronic
1161834353 19:6635557-6635579 CGAATTCAGTGGTTCTCAACTGG + Intergenic
1161880606 19:6948871-6948893 CTAGACCAATGGTTTTCAACTGG + Intergenic
1161974731 19:7602100-7602122 ATAAGGCAGTGGTTCTCAACTGG + Intronic
1163047583 19:14655817-14655839 ATAGACCAGTGGTTCTCAACGGG + Intronic
1163207074 19:15811548-15811570 CTGGATCAGCGGTTCTCAACTGG - Intergenic
1163260479 19:16186739-16186761 GTAGGTCAGTGATTCTCACCTGG + Intronic
1163358919 19:16833091-16833113 TTACACCGGTGGTTCTCAACAGG - Intronic
1163404591 19:17114142-17114164 CTAAAACAGCAGTTCTCAACTGG - Intronic
1163436438 19:17298525-17298547 CTAAGGCAGTGGTTCTCAGCTGG + Intronic
1164474524 19:28564949-28564971 GTAAGACAGTGGTTCTCAACTGG - Intergenic
1165612711 19:37170147-37170169 CCAAAGCAGTGGTTCTCAAATGG + Intronic
1165931521 19:39362275-39362297 CAAGACAAGTGGTTCTCCACTGG - Intronic
1166026195 19:40087412-40087434 ATAGAACATTGGTTCTCAGCTGG - Intronic
1166175524 19:41066263-41066285 TTAGTTCAGTGTTTCTCAAAAGG + Intergenic
1166417185 19:42604401-42604423 CTAGGTCAATGGTTCACAATTGG + Intronic
1166579722 19:43884467-43884489 GTAGATCACTGGTTCTGAACAGG + Intronic
1167064438 19:47173720-47173742 ATAATCCAGTGGTTCTCAACTGG - Intronic
1167069057 19:47209058-47209080 CTAGGGCAGTGGTTCTTAACTGG - Intronic
1167854657 19:52227770-52227792 CTAGAGCAGTAGTTCTCAACTGG - Exonic
1168070699 19:53949634-53949656 TTAGGACAGTGGCTCTCAACTGG + Intergenic
1168108126 19:54176691-54176713 TTAGACAAGTGCTTCTCAACTGG - Intronic
1168307593 19:55443744-55443766 GTAAGTCAGTGGTTCTCCACGGG - Intergenic
1168314736 19:55479763-55479785 CGATACTAGTGGTTCTCAACTGG - Intronic
1168318112 19:55493090-55493112 CTAGACTAGTGGCTCTCAGCTGG + Intronic
1168350431 19:55672595-55672617 TTAGAGCAGTGGTTGTCAACTGG - Intronic
1168357503 19:55711491-55711513 ATAGAGCAGTGGTTCTCACCTGG + Intronic
1168358963 19:55722102-55722124 CTAGCTCAGTAGTTCTCAATGGG - Intronic
1168471827 19:56646356-56646378 CTAACTCAGTGGATTTCAACTGG + Intronic
925332316 2:3068125-3068147 TTAATCCAGTGGTTCTCAACTGG - Intergenic
925568546 2:5283913-5283935 CTAGAGCAGTGGTTCTCAACTGG - Intergenic
925787943 2:7451475-7451497 TTTAATCAGTGGTTTTCAACTGG + Intergenic
925837007 2:7956019-7956041 TTGGACCAGTGGTTCTCAACTGG + Intergenic
925995018 2:9285177-9285199 TTAGAGCAGTGGTTATAAACTGG + Intronic
926159389 2:10477023-10477045 CTAGCCTAGTAGTTCTCAACTGG + Intergenic
926600081 2:14832899-14832921 ATAGAACAGTGGTTCTCACCTGG - Intergenic
926839076 2:17058499-17058521 CTAGACCATTGGTTGTCAACTGG + Intergenic
926974303 2:18497772-18497794 TTAAAGCAGTAGTTCTCAACAGG - Intergenic
927757521 2:25721043-25721065 CTAAAGCAGTGGTTCTCAAGAGG + Intergenic
927872766 2:26634023-26634045 CTAGCTTAGTAGTTCTCAACGGG + Intronic
928227474 2:29464634-29464656 GTAGGGCAGTGGTTCTCAACAGG + Intronic
928501825 2:31904704-31904726 CTAGAGCAGGGGTCCTCAGCTGG - Intronic
929143760 2:38688565-38688587 CTAAACTAGTGGTTCTCAATTGG - Intronic
929235421 2:39600398-39600420 CTAGAACAATGGTTCTTACCTGG + Intergenic
929370557 2:41219235-41219257 TTAATGCAGTGGTTCTCAACTGG - Intergenic
929482371 2:42322487-42322509 CTGAATCAGTGGTTTGCAACTGG - Intronic
929519404 2:42633981-42634003 GTAGAACAGTGATTCTCAACCGG + Intronic
929587598 2:43126217-43126239 TTAAGTCAGTGGTTTTCAACTGG - Intergenic
929698657 2:44142304-44142326 TTAGAGCAGTAGCTCTCAACTGG + Intergenic
929849931 2:45577134-45577156 CTAGAGCAGTGGTTCTCAATGGG + Intronic
929852470 2:45604875-45604897 CTAAAGCAGAGATTCTCAACTGG + Intronic
929881736 2:45842789-45842811 CCATCCCAGTGGTTCTCAACTGG - Intronic
929969252 2:46559716-46559738 CTACAACAGTGGTTCTCAACTGG - Intronic
929976385 2:46639448-46639470 TTATATTAGTGTTTCTCAACTGG - Intergenic
930016886 2:46976819-46976841 CTAGAGCAGTGGCTGTCAGCAGG - Intronic
930353475 2:50288202-50288224 CTAAAGCAGTGGTTGTCAATTGG + Intronic
930588819 2:53302451-53302473 CTAGATCAGTGGTTCTAACCAGG - Intergenic
930659932 2:54043298-54043320 TCAGACCAGTGGTTCTCAACAGG + Intronic
930828587 2:55718997-55719019 CTAGCTTAGTGGGTCTCAAACGG - Intergenic
931112068 2:59122052-59122074 CTAGGCCAGTGGTTCTCAACTGG + Intergenic
931601300 2:64005753-64005775 CTAACTCAGTGGTTCTCAACCGG - Intronic
931607581 2:64067456-64067478 TTAGATCAGAGGTTCTCAACTGG + Intergenic
931612271 2:64114850-64114872 TTAGAGCAGTGGTTCTCACAAGG - Intronic
931742001 2:65254565-65254587 CCAGGACAGTGGTTCTCACCAGG + Intronic
931801437 2:65762023-65762045 ATAGAACAGTGGTTCTCAGTTGG + Intergenic
932021465 2:68091618-68091640 TTTGATCAGTGGTTCTCAACTGG - Intronic
932105056 2:68934502-68934524 CTGAATCAGTAGTTTTCAACTGG - Intergenic
932189572 2:69729435-69729457 ATAGAGCAGTGGTTCTCAATGGG + Intronic
932244619 2:70186057-70186079 CTACATCAGTGGCTTTTAACTGG - Intronic
932458405 2:71864777-71864799 TTAAAACAGTGTTTCTCAACTGG - Intergenic
932489045 2:72106843-72106865 CTAGATCAGTGGTTCTTGATGGG - Intergenic
932810599 2:74822529-74822551 TTATACCAGTGGCTCTCAACTGG - Intergenic
932860502 2:75286550-75286572 TTAGAGCAAGGGTTCTCAACTGG + Intergenic
932909512 2:75791215-75791237 CTAGACTAGCGGTTTTCAACTGG + Intergenic
933200163 2:79438658-79438680 CTAGGACAGTGGCTGTCAACTGG - Intronic
933624375 2:84582280-84582302 CTAGAACCGTGGTTCTCAAAGGG + Intronic
933744368 2:85560075-85560097 TTAGCCCAGTAGTTCTCAACTGG - Intronic
934959443 2:98656924-98656946 CTCAACCAGTGTTTCTCAACTGG + Intronic
935210524 2:100936033-100936055 TGACATCAGTGGTTCTCAACTGG - Intronic
935611680 2:105032202-105032224 TTAGACCAGTGATTCTCAAAGGG - Intergenic
935786575 2:106554264-106554286 ATAAGTCAGTGGTTCTCAAAGGG + Intergenic
935787497 2:106562011-106562033 CTAAATCAGTGGATCTCAACAGG + Intergenic
935935679 2:108180450-108180472 CTCCATCACTGGTTCTCAAATGG - Intergenic
936061428 2:109297807-109297829 CTAGGTCAGTGCTCCTCACCAGG + Intronic
936174622 2:110209009-110209031 CTAGAGCAGTAGTTTTCAACAGG - Intergenic
936614931 2:114038947-114038969 ATAGACTAGTGGTTCTCAATCGG + Intergenic
936735192 2:115432704-115432726 TTAGCTCAGTGGTTATCAATGGG + Intronic
936740691 2:115503748-115503770 CTAGAGCAGTGTTTCTCCACTGG + Intronic
936864924 2:117066583-117066605 CTAAACCAGTGGTTTTCAAACGG + Intergenic
936924720 2:117724659-117724681 CTAAGCCAGAGGTTCTCAACTGG - Intergenic
936937479 2:117852158-117852180 CTAGATCAATGGTTCTCAACTGG + Intergenic
937291140 2:120782847-120782869 CTACAGCAGCAGTTCTCAACCGG - Intronic
937330240 2:121022126-121022148 CTATACCAGTGGCTGTCAACTGG + Intergenic
937587746 2:123574682-123574704 CTGGATCAGTATTTCTCAACAGG + Intergenic
937696152 2:124810748-124810770 CTGGGTCAATGGTTCTCAGCTGG + Intronic
937815046 2:126241993-126242015 CTAGCTCAGCAATTCTCAACTGG - Intergenic
938925654 2:136039161-136039183 CGAAATCAGTAGTTCTCAACTGG - Intergenic
938995421 2:136672764-136672786 TAGGAGCAGTGGTTCTCAACTGG - Intergenic
939293794 2:140230216-140230238 CTAGATCAGTAGTTCTGATCAGG + Intergenic
939382211 2:141450004-141450026 TGAAACCAGTGGTTCTCAACTGG - Intronic
939516686 2:143177585-143177607 CTACATCAGTGATTCTCAAAGGG + Intronic
939635395 2:144575997-144576019 ATAGACCAGTGGTTTTCAACTGG + Intergenic
939849565 2:147288308-147288330 CTATTTTAGTGGTTCTTAACAGG - Intergenic
939885654 2:147678495-147678517 CTACCTTAGTGGTTCTCAATTGG - Intergenic
939896124 2:147793181-147793203 TTAGCTCAATGGTTCTCAACTGG - Intergenic
939912428 2:147999602-147999624 TTAGGTCAGTGATTCTCAAGTGG - Intronic
939979031 2:148756883-148756905 CTAGGGAAGTGGTTCTCAAATGG - Intronic
940150260 2:150592279-150592301 TTAACTCAGTGGTCCTCAACTGG - Intergenic
940273596 2:151916749-151916771 TTAGAACAGTGGTTCCCAGCTGG + Intronic
940541738 2:155028935-155028957 GTAGAGCAATGGTTTTCAACAGG - Intergenic
940584096 2:155622202-155622224 GTAGTTCAGTGGTTCTCAATAGG + Intergenic
940627477 2:156193408-156193430 TTATATCAGTGATTCTCAACCGG - Intergenic
940969952 2:159884839-159884861 CCAGAGCAGTGGTTCTCCAGGGG - Intronic
941358815 2:164525931-164525953 CTATTGCAGTGGTTCTTAACTGG - Intronic
941467544 2:165847244-165847266 GAAGATCAGTGATTCTCAAAAGG - Intergenic
941495077 2:166190252-166190274 AGAGATCAGTCGTTGTCAACTGG + Intergenic
941505079 2:166333095-166333117 CTAAACCAGTGGTCCTCAACAGG + Intronic
941744637 2:169073881-169073903 CTAGAACAGTGGTTCTAAACTGG + Intronic
941766456 2:169302424-169302446 CTAAATCAGTGGTTCTCAACTGG + Intronic
942019870 2:171856432-171856454 CTAGAGCAGTGGTTCTCAATAGG - Intronic
942486203 2:176442513-176442535 CAAGAGCAATGGATCTCAACTGG + Intergenic
942571553 2:177320654-177320676 CCAGATCCGTGGTTCTCAACAGG - Intronic
942600575 2:177636845-177636867 GCAGAGCAGTGGTTCTTAACTGG - Intronic
942606541 2:177697895-177697917 TTAGAACAGTGGTTCTCAGCTGG + Intronic
942721672 2:178959959-178959981 TTAGAACAATGGTTCTTAACTGG + Intronic
942934148 2:181533628-181533650 CTAGAGCAGTGGTTCTCAGCAGG - Intronic
942937871 2:181579921-181579943 ATAGATCAGTGGATCTCAGATGG - Intronic
943008108 2:182411627-182411649 CTAAATCAATGGTTCTCAATTGG + Intronic
943614419 2:190076380-190076402 CTTTAACAGTGGTTCTCCACTGG - Intronic
943737523 2:191373201-191373223 CTATTTCAGTGGTTCTCAAATGG + Intronic
943744134 2:191443623-191443645 TTAAATTAGTGGTTCTCAGCTGG + Intergenic
943760389 2:191601490-191601512 TAAGAGCAGTGGTTCTCAACAGG - Intergenic
944145914 2:196507379-196507401 TTAGAGCAGTGGTTCTCAGCTGG + Intronic
944213579 2:197231539-197231561 CTAGGCCAGTGCTTCTCGACAGG + Intronic
944218103 2:197275643-197275665 CCACAGCAGTGGTTCTCAGCGGG + Intronic
944464709 2:199989253-199989275 ATGGACCAGTGGTTCTCAACTGG + Intronic
944509064 2:200446424-200446446 CCACAGCAGTGGTTCTCAATGGG + Intronic
944513270 2:200485211-200485233 TTAGAGCAATGGTTCTCAACTGG + Intergenic
944514478 2:200498649-200498671 CTAGTGCAGTGGTTCTCAACTGG - Intronic
944543697 2:200778564-200778586 CTAGAACAGTGGTTCTCAACTGG + Intergenic
944610827 2:201404963-201404985 CTAGGGCAGTCTTTCTCAACAGG + Intronic
944958979 2:204847250-204847272 ATAGAACAGTGGTTTTCAAATGG + Intronic
945005852 2:205405179-205405201 CTAGAACAGTGGTTCTCAATGGG + Intronic
945201034 2:207281687-207281709 TTAGAACAGTGGTTTTCAACTGG - Intergenic
945259909 2:207833744-207833766 TTAGGTCAGTGGTTCTCAACAGG - Intronic
945608173 2:211963117-211963139 CCAAAACAGTGGTTCTCAACTGG + Intronic
945878664 2:215304629-215304651 TTAGAGTAGTGGTTCTCATCTGG + Intergenic
946880915 2:224176322-224176344 TTAGCTCAGTGGATCTCAACTGG - Intergenic
946928100 2:224645555-224645577 CTAGATCAGCATTTCTAAACTGG - Intergenic
946928185 2:224646350-224646372 GTTGATGAGTGGTTCTTAACGGG + Intergenic
946938444 2:224746100-224746122 CTACAACAGAGGTTCTCAAATGG + Intergenic
946993771 2:225367069-225367091 CCAGATCAGTGGTTTTAAAGAGG - Intergenic
947150882 2:227114163-227114185 ATAAATCAGTGGTCCTCCACTGG + Intronic
947175902 2:227367253-227367275 CTAACACAGTGGCTCTCAACCGG - Intronic
947185315 2:227449763-227449785 TTAGGTTAGTAGTTCTCAACTGG - Intergenic
947382287 2:229556467-229556489 CCAGACCAGTGGTTCTTAACTGG - Intronic
947831201 2:233143014-233143036 CTAGCCCAGTGGTCCTCAGCTGG - Intronic
947834967 2:233168856-233168878 CTAGGTCAGTGGTTCCCAAAGGG - Intronic
948413339 2:237781898-237781920 TTACAGCAGTGGTTCTCAATGGG - Intronic
948471942 2:238187996-238188018 GTACATCAGTGATTCTCAGCTGG - Intronic
1169161267 20:3380611-3380633 CTAGTGCAGTAGTTCCCAACTGG - Intronic
1169267556 20:4175870-4175892 CTAGGTCAGGGCTTCCCAACTGG + Intronic
1169471474 20:5889443-5889465 CTGTACCAGTGGTTCTCAACTGG + Intergenic
1169546902 20:6659714-6659736 TTAGAACAGTGCTTCTCAATAGG - Intergenic
1169675073 20:8144049-8144071 TTTCATCAGTGGTTCTCAACTGG - Intronic
1170244577 20:14206248-14206270 CTAGATCACTGGTTCTTGACTGG + Intronic
1170320100 20:15086480-15086502 CTAGAACTGTGGTTTTCAACAGG - Intronic
1170333073 20:15236933-15236955 CTAAACCAGTGGTTCTCAGTGGG + Intronic
1170584208 20:17722074-17722096 CTGCAACAGTGGTGCTCAACTGG - Intronic
1170713776 20:18814874-18814896 CTAGGCCAGTGGTTCTTAACTGG + Intronic
1170816160 20:19716189-19716211 TTAGAGCAGTGGTTCTCAGAGGG - Intronic
1170849489 20:19991571-19991593 TTACATCAGTGGTTCTCAACTGG - Intronic
1170913322 20:20596953-20596975 TTAGAGCAGTGATTCTCAATTGG - Intronic
1170934155 20:20795441-20795463 CTAGATCAGTGATTCTCCACTGG - Intergenic
1171024125 20:21613441-21613463 CGAGAGCAGTGGTGCTCAAAGGG + Intergenic
1171186366 20:23126835-23126857 TTAGAGCAGTGGCTGTCAACAGG - Intergenic
1171433296 20:25100771-25100793 CTAGAGCAGTGGGACTCAACTGG + Intergenic
1172179448 20:32992284-32992306 CTAAATCAGTGGTTCTCAATTGG - Intronic
1172301342 20:33852630-33852652 CTAGAAAAGAGGCTCTCAACTGG - Intronic
1172683395 20:36734835-36734857 TTAGAGCAGTGCTTCTCAATTGG - Intronic
1172808636 20:37631673-37631695 CTGGATCACTGGTTTTCATCTGG - Intergenic
1172979947 20:38933481-38933503 CTAGGCCAGTGGTTCACAACTGG - Intronic
1173005046 20:39133868-39133890 CTACAACAGTGGTTTTCAACTGG + Intergenic
1173094595 20:40013021-40013043 CTAAATCAGTGGTTTTCAACTGG + Intergenic
1173172397 20:40737994-40738016 CTAGATCAATGATTCTCAACAGG + Intergenic
1173190679 20:40873332-40873354 TTACACCAGTGGTTCTCAATTGG - Intergenic
1173447732 20:43135063-43135085 CTAACTCAGTGGTTCTCAACTGG - Intronic
1173835979 20:46126042-46126064 TTAAACCAGAGGTTCTCAACAGG + Intronic
1173863954 20:46302429-46302451 TTAGATCAGTGTTTTTCAACTGG - Intronic
1173865749 20:46311712-46311734 CTAGAGCAGTGGCTCTCAACTGG - Intergenic
1174103258 20:48143399-48143421 CTAGACTAGTGGTTCTCAACTGG - Intergenic
1174191563 20:48744257-48744279 CTAGAGCAGAGCTTCTCAGCTGG - Intronic
1174203077 20:48820614-48820636 TTAGCCCAGTGGTTCTCAACTGG + Intronic
1174204806 20:48830423-48830445 TTACATCAGTGGTTCTCAACAGG - Intergenic
1174233142 20:49063996-49064018 TTAGGACAGTGATTCTCAACTGG + Intronic
1174283482 20:49455880-49455902 CCAGACCAGAAGTTCTCAACGGG - Intronic
1174433032 20:50484609-50484631 TTACCACAGTGGTTCTCAACTGG - Intergenic
1174443011 20:50570891-50570913 CTAGAGCGGTGGTTCTCAACCGG - Intronic
1174497052 20:50954248-50954270 CTATACCAATGGTTCTCTACTGG + Intronic
1174517870 20:51107121-51107143 CCAGGTCAGCAGTTCTCAACTGG + Intergenic
1174547386 20:51335797-51335819 TCAGACCAGTGGTTCTCACCTGG + Intergenic
1174603291 20:51741949-51741971 CTAGAGCAGGAGTTCTCAACTGG - Intronic
1174622528 20:51887034-51887056 TGAGATCAGTGGTTCTCAACTGG + Intergenic
1174647768 20:52100972-52100994 CTAGTCCAGTGGCTCTCAACTGG + Intronic
1174668895 20:52287113-52287135 CTATAGCAGTGGTTCTCAATGGG - Intergenic
1174672170 20:52318558-52318580 CTACAGCCATGGTTCTCAACTGG - Intergenic
1174684187 20:52437850-52437872 CTAGTACAGTGGTTCTCAAGTGG - Intergenic
1174734992 20:52957349-52957371 TTACATCAGTGGTTCTCAGATGG + Intergenic
1174741135 20:53015310-53015332 CGGGAACAGTGGTTCTCAACTGG + Intronic
1174750652 20:53108174-53108196 CTAAAGTTGTGGTTCTCAACAGG - Intronic
1174754872 20:53148231-53148253 CTAGAACAGTGGTTCTCAACTGG + Intronic
1174781111 20:53389687-53389709 CCAGACCTGTGGTTTTCAACAGG + Intronic
1174859521 20:54077436-54077458 CTACCCCAGTGGTTCTCAACGGG - Intergenic
1174994429 20:55550274-55550296 TTAAAGCAGTGGTTCTCAACTGG + Intergenic
1175042786 20:56071560-56071582 CTAAGCCAGTGGTCCTCAACAGG + Intergenic
1175050663 20:56152396-56152418 CTCACTCAGTGGTTCTCAACTGG - Intergenic
1175122048 20:56723308-56723330 CTAGTCCAAAGGTTCTCAACAGG - Intergenic
1175188097 20:57193253-57193275 TTAGCTCAGTGGCTCCCAACTGG + Intronic
1175197252 20:57252830-57252852 CTAAACCAGTGGTTCTCAACTGG + Intronic
1175246140 20:57583257-57583279 CTACATCAGTAGATCTCAGCTGG - Intergenic
1175270621 20:57731378-57731400 CTAGCCCAGTGGTTCCCAACTGG - Intergenic
1175417238 20:58809972-58809994 TTATCTCAGTGGTTCTCAACTGG - Intergenic
1175476712 20:59280548-59280570 GTACATCAGTGGTACTCAGCTGG - Intergenic
1175590333 20:60184848-60184870 CTATTCCAGTAGTTCTCAACCGG + Intergenic
1175663579 20:60838744-60838766 ACAGTTCAGTGGCTCTCAACTGG - Intergenic
1175678592 20:60967833-60967855 TTAGAGCAGTGGCTCTCAACTGG - Intergenic
1175721842 20:61292446-61292468 CTAGTCTAGTGGTTCTCAAAGGG + Intronic
1175792649 20:61751347-61751369 GTAGTTCAGTGGTTCTCAAAAGG - Intronic
1175866009 20:62177100-62177122 GTAGCCCAGTGGTTCTCAAACGG - Intronic
1176672471 21:9747272-9747294 CTAGGCCAGTGGTTCTCCAACGG - Intergenic
1176725654 21:10430314-10430336 CTAGAACAATGGCTCTTAACTGG - Intergenic
1176960295 21:15152032-15152054 CTAGGACGGTGGTGCTCAACTGG - Intergenic
1177163159 21:17571106-17571128 ATAAATCCGTGGTTCTCAAAAGG - Intronic
1177595513 21:23235908-23235930 CTGCATCAATGATTCTCAACTGG - Intergenic
1177650188 21:23950334-23950356 CTAGTCCAGTGGTTTGCAACTGG + Intergenic
1177888303 21:26773368-26773390 CTAATTCAGTGGTTCTCAACTGG - Intergenic
1178083927 21:29094085-29094107 CTAGGGCAATGGTTCTCAACTGG + Intronic
1178160978 21:29914240-29914262 CTTAAACAGTGGTTCTCTACTGG - Intronic
1178232232 21:30799276-30799298 CTAGATCAATGAATCTCAAAAGG + Intergenic
1178269404 21:31176012-31176034 TTAGGCCAGTAGTTCTCAACTGG + Intronic
1178754193 21:35332383-35332405 CGAGAGCAATGGTTCTCAAGAGG + Intronic
1178812494 21:35896872-35896894 CTAGTGCAGTGGCTCTCAACTGG + Intronic
1178847155 21:36183324-36183346 CTACAGCAGTGGTTCTCAACTGG - Intronic
1178905851 21:36635429-36635451 CTAAACCAGTGGTTCTTAGCCGG + Intergenic
1178906471 21:36641150-36641172 CTTTCTAAGTGGTTCTCAACAGG - Intergenic
1179036817 21:37765353-37765375 CAAGATCAGTGGTTCTGAACTGG + Intronic
1179070459 21:38066149-38066171 CTAGATCAGGGGTTCTCACTGGG + Intronic
1179105213 21:38394232-38394254 CTAGATCTCTGTTTCTCAAAGGG + Intronic
1179117981 21:38511946-38511968 CTGTTCCAGTGGTTCTCAACTGG - Intronic
1179146003 21:38768426-38768448 TTCTATCAGAGGTTCTCAACTGG + Intergenic
1179282786 21:39949390-39949412 TTAAATAAGTGATTCTCAACTGG + Intergenic
1179342023 21:40521086-40521108 GTAGAACAGTGTTTCTCAACCGG + Intronic
1179451480 21:41471342-41471364 TTAGGCCAGTAGTTCTCAACTGG + Intronic
1179964367 21:44792762-44792784 CTGGATCAGGGCTTCTCAGCAGG - Intronic
1180643510 22:17318706-17318728 CTGGTGCAGTGGTTTTCAACTGG + Intergenic
1180654451 22:17407690-17407712 GTCTAACAGTGGTTCTCAACGGG + Intronic
1180692380 22:17727950-17727972 CTAAAGCAGTGGGTCTCAATAGG - Exonic
1180713208 22:17854137-17854159 CTAGATCCGTGATTCTCAACTGG + Intronic
1180986942 22:19910480-19910502 CTAGGTCAGTGGTTGTCAAATGG - Intronic
1181849060 22:25736751-25736773 CTAAACCAGTGGTTCTCAAATGG - Intergenic
1181884914 22:26013174-26013196 CTATGTCAGTGGTTCTCAACTGG + Intronic
1181913213 22:26256985-26257007 CTGGGCCAGTGGTTTTCAACAGG + Intronic
1182220634 22:28755943-28755965 CCAGACCAGTGATTTTCAACTGG - Intronic
1182243698 22:28937689-28937711 CTAGATCAGTGGTTCTCAAAGGG - Intronic
1182530590 22:30953067-30953089 CTAGTTTAGTGCTTCTCAAAAGG - Intronic
1182655011 22:31883198-31883220 CTAGGACAGCGGTTCTCAGCTGG - Intronic
1182656447 22:31894135-31894157 CTAAACCAGTGATTCTCAAGAGG - Intronic
1182779430 22:32855815-32855837 CTAATACAGTGGTTCTCAACTGG - Intronic
1182855002 22:33509260-33509282 TGAGGCCAGTGGTTCTCAACAGG - Intronic
1182886090 22:33775481-33775503 CTAAGTCAGTGGTTCTCAATAGG + Intronic
1183271302 22:36864240-36864262 CTATCTCAGTGGTTCTCAACAGG + Intronic
1183296233 22:37031115-37031137 CTAGGGCAGTGGTTCTTGACTGG - Intergenic
1183430028 22:37759743-37759765 CTAGGACAGCGGTTCTCAACGGG + Intronic
1183564325 22:38602373-38602395 TTAGAATAGTGGTTCTCAACTGG - Intronic
1183724756 22:39582290-39582312 CTATATCAGTGGTTTTCAATCGG + Intronic
1183763674 22:39849263-39849285 CTGAATCAGCGGTTCTCTACTGG + Intronic
1184053661 22:42029002-42029024 CTAGAATAGTGGTCCTCAGCAGG - Intronic
1184227494 22:43137549-43137571 GTAGGACAGTGGTGCTCAACAGG + Intronic
1184530681 22:45053518-45053540 CCAGATCAGGGGCTCTCAGCTGG + Intergenic
1184665997 22:45989399-45989421 TTAGACCAGTGGTTCTCAACTGG - Intergenic
949343306 3:3052417-3052439 GTAGCTCAGTGGTTTTCAACAGG - Intronic
949348249 3:3097503-3097525 CTGGTGCAGTGATTCTCAACTGG + Intronic
949352150 3:3134954-3134976 CTAGATCATTGTTTTCCAACTGG + Intronic
949499493 3:4665882-4665904 CTACATCATTGGTTCTTAACTGG + Intronic
949558141 3:5176817-5176839 CTACATCAGTGGTTCTCAATGGG + Intronic
949620528 3:5806474-5806496 GTAAAGCAGTGGTTCTCAACTGG - Intergenic
949676817 3:6464062-6464084 CTAGACCAGTTGTTCTTAAAGGG - Intergenic
949703044 3:6781161-6781183 TTGCAGCAGTGGTTCTCAACTGG + Intronic
950289262 3:11770428-11770450 TTCGATCACTGGCTCTCAACTGG + Intergenic
950751875 3:15135566-15135588 TTAGAGCAGTGGTTCCCAAATGG + Intergenic
950959333 3:17088628-17088650 TTAGCCCAGTGGTTTTCAACTGG + Intronic
950963137 3:17126472-17126494 CTAGATCAGTCATTCTCAACTGG - Intergenic
951013938 3:17708666-17708688 TTAGAACAGTGGTTCTGAATAGG - Intronic
951048842 3:18071857-18071879 CTAAATCAGTACTTCTCAACTGG - Intronic
951511876 3:23511310-23511332 CTAACACAGTGGTTCTCAACAGG - Intronic
951551278 3:23877615-23877637 TTAGAGCAGTGGTTCTCAACTGG - Intronic
951563457 3:23989880-23989902 CTAGTACAGTGGTTCTCAAAGGG + Intergenic
951581850 3:24173027-24173049 TTAGGTCAGTGATTCTCAAATGG + Intronic
951644872 3:24878734-24878756 CGACAGGAGTGGTTCTCAACTGG - Intergenic
951685676 3:25341612-25341634 TTAAATCAGTAGTTCTCAACTGG + Intronic
951704166 3:25527055-25527077 TTAGAGCAGTGCTTCTCAAATGG + Intronic
952070397 3:29627515-29627537 TTAGAGTAGTGGTTCTCAACTGG - Intronic
952223926 3:31354109-31354131 CTAGAGCAGTGGTTCTCAACTGG + Intergenic
952521870 3:34168942-34168964 CTAGGGCAGTGGTTCTGAACTGG + Intergenic
952853647 3:37749911-37749933 CCAGATCTGTGGGTCTCAAGTGG + Intronic
953093424 3:39751977-39751999 CTAGAGCAGGGATTCTCAACTGG - Intergenic
953103287 3:39851364-39851386 CTAAACCAGTGATTCTCAGCAGG - Intronic
953156856 3:40383481-40383503 TTAGACCAGTGGTTCTCACCAGG + Intergenic
953843824 3:46410944-46410966 CTGGAACAGTGGTTCTCAGAAGG - Intronic
954079887 3:48207431-48207453 CAGGATCAGTGGTTCTCAACTGG + Intergenic
954198415 3:49009645-49009667 CTAATCCAGTGGTTCTCCACAGG - Intronic
954422928 3:50428090-50428112 TTAGGCCAGTGGTTCTCAACTGG + Intronic
954567838 3:51613844-51613866 CTAAAGCAGTGATTCGCAACTGG + Intronic
954789318 3:53119519-53119541 CTAGCACAGTGGTTGTCAACTGG + Intronic
955010798 3:55012585-55012607 CTAGAACAGTGGTTTTCAAATGG + Intronic
955036506 3:55273236-55273258 CTCGACTAGTGGTTCTCAACTGG - Intergenic
955063932 3:55518170-55518192 CTAGGCCAGTGGTTGTCAAGTGG - Intronic
955065311 3:55528914-55528936 CTAAGTCAGCAGTTCTCAACCGG - Intronic
955138628 3:56246433-56246455 TTAGAACAGTGGTTGTCAACAGG - Intronic
955279744 3:57582911-57582933 TTAGAACAGTGGTTCTCAGCAGG + Intronic
955376862 3:58404538-58404560 ATAGGTCAGTAGCTCTCAACTGG - Intronic
955531080 3:59873743-59873765 CTAGACCAGTGGTTCTCAGTTGG - Intronic
955533121 3:59894995-59895017 TTAGGGCAGGGGTTCTCAACTGG + Intronic
955709638 3:61764797-61764819 CTAGAGAAGTAGTTCTCAAGTGG + Intronic
955744961 3:62131312-62131334 AGAGAGCAGTGGTTCTCAAATGG - Intronic
955761770 3:62292617-62292639 TTAGAGCAGTAGTTCTCAATTGG + Intronic
955775557 3:62428759-62428781 GCAGATCAGTGGTTCTCAAATGG + Intronic
955804817 3:62722988-62723010 CTAGATCAGTGGTTCTCAACTGG - Intronic
955867700 3:63402360-63402382 TTAGAGCAGTGGTTCTCAACTGG - Intronic
955934854 3:64092809-64092831 TGAAACCAGTGGTTCTCAACAGG + Intergenic
955938287 3:64123434-64123456 TTAGATTAGTGATGCTCAACTGG + Intronic
955951159 3:64243436-64243458 CTAGACCACTGGTTCCCAAGGGG - Intronic
955981781 3:64534690-64534712 CTAAATCAGTGGTTCTCAACAGG + Intronic
956018695 3:64911097-64911119 CTAGATCCATCGTTTTCAACGGG - Intergenic
956091421 3:65671473-65671495 TTATAGCAGTGGTTTTCAACCGG - Intronic
956096031 3:65717243-65717265 CTCAACCAGTGGTTCTCAACTGG + Intronic
956100030 3:65758551-65758573 CCAAAGCAGCGGTTCTCAACTGG + Intronic
956127848 3:66027952-66027974 CTGAATCAGTGGTTCTCAGCTGG - Intronic
956142918 3:66163832-66163854 TTAGACTAGTGGTTCTCACCTGG + Intronic
956184609 3:66550651-66550673 ATAAATTAGTGGTTTTCAACTGG + Intergenic
956272366 3:67461780-67461802 CCAGATCAGCTGTTCTCAGCTGG - Intronic
956314326 3:67917075-67917097 ACAGAGCAGAGGTTCTCAACAGG - Intergenic
956376078 3:68614984-68615006 CTACAGCAGTCGTTCTCAACTGG - Intergenic
956452718 3:69390362-69390384 CTAGTTCAATGGTTCTCAACCGG + Intronic
956492950 3:69793615-69793637 TTATAGGAGTGGTTCTCAACAGG - Intronic
956544257 3:70382383-70382405 TTACATCAGTGGTTCTCAAATGG + Intergenic
956551431 3:70464278-70464300 CAACATCAGTGGTTGTAAACTGG - Intergenic
956562291 3:70593242-70593264 TTAGAGCAGTGGTTTTCAACAGG + Intergenic
956707930 3:72015385-72015407 CTAGTCCAGTGATTCTCAACTGG - Intergenic
956734714 3:72229385-72229407 CTAGGGCAGTGGTTTTCAACCGG - Intergenic
956739078 3:72260863-72260885 CTGGAGCAGTGGTTCTGAAGTGG + Intergenic
956846063 3:73183906-73183928 TTAGGTCAGTGGTTTTAAACTGG + Intergenic
956946257 3:74226828-74226850 CTTGAGCAGAGGTTCTCAACAGG + Intergenic
957072241 3:75576414-75576436 GTAGACCAATGGCTCTCAACTGG + Intergenic
957351999 3:79036354-79036376 CCAGACCAGTGGTTATCAAGTGG - Intronic
958813106 3:98885762-98885784 TTAGAGCAGTGATTCTCAAAAGG + Intronic
958898262 3:99854700-99854722 ATAGATCAGTAGTTCTCAACTGG - Intronic
958991527 3:100851538-100851560 CTGGAGCAGTAGTTCTCAAATGG - Intronic
959245826 3:103866296-103866318 TTAGATCAGCAGTTCTCATCTGG - Intergenic
959417283 3:106090761-106090783 CTAAACCAGAGGTTCTCAAAAGG - Intergenic
959583790 3:108007304-108007326 CTAGAGCAGTGCTTCACAACTGG + Intergenic
959983155 3:112541012-112541034 CTAATGCAGTGATTCTCAACTGG + Intronic
960170854 3:114459345-114459367 CTTGACCACTGGTTCTCAAAAGG - Intronic
960188082 3:114669038-114669060 CCAATTCAGTGGTTCTTAACTGG + Intronic
960373198 3:116866414-116866436 TTAGACCAATGATTCTCAACTGG + Intronic
960466205 3:117998687-117998709 ATAGATAAGAAGTTCTCAACTGG - Intergenic
960705076 3:120473873-120473895 CTAGACCAGTGGTTCTCAACCGG - Intergenic
960724221 3:120653994-120654016 CCAGGTCAGTGGTTCTCAACTGG - Intronic
961072028 3:123941111-123941133 CTAGCTCAATGGCTCTTAACTGG + Intronic
961121278 3:124373242-124373264 CTAAAATGGTGGTTCTCAACTGG + Intronic
961281834 3:125770361-125770383 GTAGACCAATGGCTCTCAACTGG - Intergenic
961642154 3:128371500-128371522 TTAGACCAGTGGTTCTCAACTGG - Intronic
961661541 3:128471207-128471229 CTAAATCAGTGGTTCTCAACAGG + Intergenic
961872512 3:129999221-129999243 GTAGACCAATGGCTCTCAACTGG + Intergenic
962034136 3:131632915-131632937 CTAGGTCAGTGGTTCTCCACTGG - Intronic
962037408 3:131667347-131667369 CTATACCAGTGGTTCTTAACTGG + Intronic
962100971 3:132342296-132342318 GAAGAACAGCGGTTCTCAACAGG + Intronic
962293787 3:134161521-134161543 CTAACACAGTGGTTCTTAACTGG - Intronic
962416748 3:135189716-135189738 GTAGAACAGAAGTTCTCAACTGG + Intronic
962792029 3:138820268-138820290 GTAGGTCAGTGTTTCTCATCTGG - Intronic
962853315 3:139323942-139323964 CTAGGACAGAGGTTCTCAACTGG - Intronic
962932575 3:140051637-140051659 AGAGAACAGTGGTTCTCAACCGG + Intronic
963162195 3:142162264-142162286 CTGTATCAGTGGCTCTCAACTGG + Intergenic
963414234 3:144973969-144973991 ATAGAGCAATGGTTCTCTACTGG - Intergenic
963574497 3:147042859-147042881 TTAATTCAGTGGTTCTCAATAGG - Intergenic
963612493 3:147488303-147488325 TTAGCCCAGTGGTTCTTAACTGG + Intronic
963650628 3:147975373-147975395 TTTGACCAGTGGTTCTCCACTGG - Intergenic
963665757 3:148184025-148184047 TTACAGCAGTGGTTCTCAACTGG - Intergenic
963756769 3:149242610-149242632 TTAGTACAGTGGTTCTCTACAGG + Intergenic
963883532 3:150554641-150554663 CTAGATCAGTGGTTCTTAAAGGG - Intronic
963902604 3:150746686-150746708 CAGAGTCAGTGGTTCTCAACTGG - Intronic
963941166 3:151097601-151097623 CTAGAGCAGTGGATTTCAACTGG + Intronic
964107268 3:153052623-153052645 CTAAAGCAATGGTTCTCAAAGGG - Intergenic
964190693 3:153997584-153997606 GATGAACAGTGGTTCTCAACAGG - Intergenic
964215763 3:154279684-154279706 CTTGGGCAGTGGTTCTCAACTGG - Intronic
964229920 3:154453922-154453944 TTAGACCAGTGGTTCTTAAATGG - Intergenic
964508258 3:157422571-157422593 CTAGAGCAGAGGTCCCCAACTGG - Intronic
964723867 3:159794463-159794485 CTAATGCAGTGATTCTCAACAGG + Intronic
964896862 3:161608304-161608326 CTAGGTCATGGATTCTCAACTGG + Intergenic
965105786 3:164350676-164350698 GTAGATCAGTGGCTCTAAATAGG - Intergenic
965167824 3:165219086-165219108 CTATACCAGTGGTTCTCAGTTGG - Intergenic
965195852 3:165593152-165593174 CTAAAACAGTGTTTCTCAAACGG + Intergenic
965233417 3:166083098-166083120 CTATAGCCGTGGTTCTCAACTGG + Intergenic
965515031 3:169612120-169612142 CTAGATTAGTGATTCTCAACTGG - Intronic
966737414 3:183198773-183198795 CTAGGTCAGTGTTTCTCAAAGGG - Intronic
966762897 3:183432768-183432790 CTAGGCCAGTGGTGCTCAAAGGG - Intergenic
966825500 3:183961719-183961741 TTAGTTCAGTAGTTCTCTACAGG + Intronic
967187419 3:186956749-186956771 CATGATCAGTGCTTCTGAACTGG - Intronic
967664931 3:192159669-192159691 CTAGGGCAGTGGTTGTCAAGCGG + Intronic
967671618 3:192242457-192242479 CTACTTCAGTGGTTCTCAACTGG - Intronic
967706426 3:192656458-192656480 CTAGTGCAGTGGTTCTCAGCCGG + Intronic
967841188 3:194005907-194005929 CCAGAGCAGAGGTTCTTAACAGG - Intergenic
967899051 3:194428350-194428372 AAAGATAAGTGGTTCTCAACTGG + Intronic
968018912 3:195366191-195366213 CTAAGGCAGTGGTTCTCCACTGG + Intronic
968678526 4:1899475-1899497 CTAGAACAGCGGTTCTCAAATGG - Intronic
969015830 4:4103726-4103748 GTAGACCAATGGCTCTCAACTGG + Intergenic
969113401 4:4857195-4857217 CTAAAGCAGGGGTTCTTAACTGG + Intergenic
969185740 4:5473034-5473056 CTAAAGCACTGGCTCTCAACTGG - Intronic
969738126 4:9004626-9004648 GTAGACCAATGGCTCTCAACTGG - Intergenic
969797314 4:9536170-9536192 GTAGACCAATGGCTCTCAACTGG - Intergenic
970061121 4:12035709-12035731 CTACACCAGTGGTTCTAAACTGG + Intergenic
970433792 4:16013636-16013658 CTATACCAGTGGTTCTCAACTGG + Intronic
970434914 4:16023874-16023896 TTAGCTTAGTGCTTCTCAACTGG - Intronic
970476463 4:16428867-16428889 CTAAACCAGTGGTTTTCAACGGG + Intergenic
970606351 4:17685663-17685685 CTACAGAGGTGGTTCTCAACTGG + Intronic
970681608 4:18514918-18514940 TTAGATCATTACTTCTCAACTGG + Intergenic
970710371 4:18855092-18855114 CCTTATTAGTGGTTCTCAACTGG - Intergenic
970761031 4:19486726-19486748 CTACACCAGTAGTTCTAAACCGG - Intergenic
971116165 4:23647861-23647883 CTACAGCAGTACTTCTCAACCGG + Intergenic
971190828 4:24427655-24427677 CTAGAACAGGGGTTCTCAAGGGG + Intergenic
971216449 4:24666333-24666355 CTAGAGCAGAGATTCTCAACAGG + Intergenic
971265182 4:25090671-25090693 TTAGATCATTGGTTCTCCAAAGG - Intergenic
971269220 4:25123413-25123435 CAAAAGCAGTGGGTCTCAACTGG - Exonic
971465339 4:26952324-26952346 TTAGATCAGTGATTATCAGCTGG + Intronic
971509819 4:27410375-27410397 CTCAATCAGTGGTTCTCAGCAGG - Intergenic
971723508 4:30277853-30277875 TTCATTCAGTGGTTCTCAACTGG - Intergenic
972234566 4:37115977-37115999 CTAAAGCAGTGGTTCTCACCTGG + Intergenic
972291133 4:37690986-37691008 CCAGCTCAGTGGTTATCAACTGG - Intergenic
972302051 4:37793631-37793653 CTAAACTAGTGGTTCTCAAGAGG + Intergenic
972842131 4:42943753-42943775 CTAGGTCAGTGGCTCTCAAGTGG + Intronic
972952498 4:44344836-44344858 TTAGAGCAGTGTTTCTCAAATGG - Intronic
973138885 4:46741466-46741488 ATACAGCAGTGGTTCTGAACTGG - Intronic
973200693 4:47498424-47498446 TTAGAGCAGTGGTCCTCAAATGG - Intronic
973323795 4:48836846-48836868 CTAAAACAGTTATTCTCAACTGG + Intronic
973576741 4:52297253-52297275 ATATCTTAGTGGTTCTCAACTGG - Intergenic
973881061 4:55271556-55271578 CTAGATCAGTGGTACATAGCAGG + Intergenic
973980776 4:56306613-56306635 CTAGAGCAGTGGTTCTCAGCTGG + Intronic
973988642 4:56380895-56380917 CTAAAGCAGTAGTTCTCAACTGG - Intronic
974711090 4:65596228-65596250 TTGGATTAGTGGTTCTCAACTGG + Intronic
974882163 4:67773366-67773388 CTAGTGTAGTGGTTCTCAATGGG + Intergenic
974893461 4:67909075-67909097 CCAGAATAGTGGTTCTCAAAAGG + Intergenic
975283257 4:72587658-72587680 GTACAGCGGTGGTTCTCAACTGG - Intergenic
975288197 4:72645270-72645292 ATAGACCAGTGGTTCTCATCTGG - Intergenic
975288389 4:72647204-72647226 AGAGAGCAGTGGTTCTCAGCTGG + Intergenic
975311192 4:72905542-72905564 TTAGAGCCATGGTTCTCAACTGG + Intergenic
975540341 4:75503253-75503275 CCAGAGCACTGGTTCTCAACTGG - Intronic
975605615 4:76151022-76151044 TTATAGCAGTGGTTCTCAACTGG + Intergenic
975885479 4:78959508-78959530 CTAAATCAACAGTTCTCAACTGG + Intergenic
976406183 4:84662575-84662597 TTGGACCAGTGGTTCTCAAGGGG + Intergenic
976466122 4:85370528-85370550 CCAGTTCAGTGGTTCTGAACTGG + Intergenic
976485720 4:85601599-85601621 TTAATACAGTGGTTCTCAACTGG - Intronic
976568310 4:86578099-86578121 CAAGATCAGTGGTTTTCAACTGG + Intronic
976698278 4:87941555-87941577 CTAGATCTGTGATTTTCAAAAGG + Intergenic
976841466 4:89437318-89437340 CTAAAACAATGGTTCTCAACTGG + Intergenic
976950169 4:90818780-90818802 CTGTAGCAGTGGTTCTCACCTGG - Intronic
977007627 4:91590991-91591013 TTAGGGCAGTGGTTCTCAACTGG + Intronic
977184009 4:93914566-93914588 TTAGATCAGTGGTTTTCAACTGG - Intergenic
977265962 4:94854831-94854853 CTAGAGCAGAGGTTCTCAAGGGG - Intronic
977302331 4:95282009-95282031 CTAGACCTGTGGTTCTCAACTGG - Intronic
977367386 4:96087805-96087827 CCAGGCCAGTGGTTTTCAACTGG - Intergenic
977531561 4:98206722-98206744 ATATATCAGTGGTTGTCAACAGG - Intergenic
977593536 4:98852672-98852694 CTAAATCAGTGGTTCTCAACTGG - Intergenic
977697992 4:99988578-99988600 ATAGACCAGTGCTTCTCAGCTGG - Intergenic
978095025 4:104765854-104765876 TCAGAACAGTGGTTCTTAACTGG - Intergenic
978192184 4:105926568-105926590 CTCTATCAGTGATTCTCAACTGG - Intronic
978302131 4:107282265-107282287 TTAAAGCAGTGGTTCTCAACTGG + Intronic
978594413 4:110361313-110361335 CTAGAGTAATGGTTTTCAACTGG + Intergenic
978608668 4:110511465-110511487 GTAGATGAGTAGTTTTCAACTGG - Intronic
978742420 4:112152173-112152195 CTAAATCAGTGGTTCTCAACTGG + Intronic
979225925 4:118284307-118284329 CTAGGTCAGAGGTTCTCAACTGG - Intronic
979289190 4:118961063-118961085 CTGCAACAGTGGTTCTCAACTGG + Intronic
979652296 4:123149510-123149532 CTAAATCAGTGATTATCAAAAGG + Intronic
979957253 4:126969204-126969226 GTAGAACGGTGGTTCTCAACTGG - Intergenic
980027923 4:127788613-127788635 CTAGGGCAGAGGTTCTCAACTGG + Intronic
980070128 4:128235012-128235034 CTAGACCAGTGGTTGTCAGGTGG + Intergenic
980720593 4:136689633-136689655 CTTTCCCAGTGGTTCTCAACAGG - Intergenic
980772661 4:137396781-137396803 CTAGATTAGTGATTTTCAACTGG - Intergenic
981157311 4:141454333-141454355 CTGGATCACTGGTTAGCAACTGG - Intergenic
981309937 4:143287803-143287825 TTAGAATAGTGTTTCTCAACTGG - Intergenic
981350427 4:143723020-143723042 CTAGAGAAGTGTTTCTCAACAGG - Intergenic
981435064 4:144710622-144710644 CTAGAACAGTGATTCTCAATGGG + Intronic
981536046 4:145800843-145800865 TTAGATGTATGGTTCTCAACTGG - Intronic
981715501 4:147747890-147747912 CTAGACCAGTGGTTCTCAAATGG + Intronic
981912703 4:150000308-150000330 ATAGAGCAGTAGTTCTCACCTGG + Intergenic
982115247 4:152093595-152093617 ATGGATCAGTGGATTTCAACCGG - Intergenic
982300160 4:153870085-153870107 CTAGAACAGTGGTTTTCAAAGGG - Intergenic
982653556 4:158118254-158118276 CTAAAGCAGTGGTTCTCAACTGG + Intergenic
982793953 4:159623622-159623644 CTAGCTTAGTGGTTCTCAACTGG - Intergenic
983533611 4:168834323-168834345 CTAAGTCAGTGGTCCTCACCTGG - Intronic
983573367 4:169234118-169234140 CTAGAACAGTGGATCTCCACTGG + Intronic
983573472 4:169234997-169235019 CTAAAACAGTGATTCTCAATGGG - Intronic
983620314 4:169754687-169754709 CTAGAGCAGTGGTTCTCAACCGG + Intronic
984032689 4:174624459-174624481 ATAGATCAGTGGTTACCAATGGG + Intergenic
984194347 4:176640447-176640469 TTAGACAAGTGGTTCTCAACTGG - Intergenic
984954706 4:185033769-185033791 CCAGCTCAGAGGCTCTCAACTGG + Intergenic
985119133 4:186622348-186622370 CTAGGTCAGTGGTTTTCCCCTGG + Intronic
985141370 4:186843510-186843532 CCAGAGCAGCAGTTCTCAACTGG + Intergenic
985156965 4:186999292-186999314 CTGAAAGAGTGGTTCTCAACTGG + Intergenic
985402259 4:189604559-189604581 CTAGGCCAGTGGTTCTCCAACGG + Intergenic
985779211 5:1861154-1861176 TTAAGTCAGTGCTTCTCAACTGG - Intergenic
986130816 5:4928309-4928331 CTGGAGCACTTGTTCTCAACCGG - Intergenic
986445037 5:7814300-7814322 TTAGTGCAGTGATTCTCAACTGG + Intronic
986489798 5:8277640-8277662 GCAGAGCAGTAGTTCTCAACCGG - Intergenic
986548136 5:8922395-8922417 CCAGAGCAGTGGTTCTCAGCTGG + Intergenic
986732203 5:10643403-10643425 TTATATCAGTGGTTCTCGATGGG - Intronic
986770481 5:10968408-10968430 CTAGAGTAGTGGTTCTCAACTGG + Intergenic
986813915 5:11387193-11387215 CTAGAGCAGTGGTTTTCAAAGGG + Intronic
986888195 5:12266397-12266419 CTAAAGCATTGGTTCTCAACTGG + Intergenic
987026604 5:13933126-13933148 TCATATCAGTGGTTCTGAACAGG - Intronic
987174286 5:15291550-15291572 TTAGACCAGTGATTCACAACTGG - Intergenic
987340194 5:16933147-16933169 CTAGCTCAGTGGATCTCAACTGG + Intronic
987788467 5:22533135-22533157 CTGTATCAGTGGTTCTCAACAGG + Intronic
988418749 5:30979192-30979214 ATAGGGCAGTGGTTTTCAACTGG - Intergenic
988468568 5:31514734-31514756 CTGTAACAGTGATTCTCAACTGG + Intronic
988518986 5:31929510-31929532 ATATGCCAGTGGTTCTCAACTGG - Intronic
988840886 5:35082604-35082626 TAAAAGCAGTGGTTCTCAACTGG - Intronic
988876519 5:35453061-35453083 GTATCCCAGTGGTTCTCAACAGG - Intergenic
988919638 5:35928587-35928609 ATAGAGAAGTGCTTCTCAACTGG + Intronic
989106081 5:37864435-37864457 CTAGGCCAGTGGTTCTTAAGTGG - Intergenic
989154862 5:38334872-38334894 TTAAATCAACGGTTCTCAACGGG + Intronic
989246328 5:39259032-39259054 ATAAACCAGTGATTCTCAACTGG + Intronic
989375598 5:40756716-40756738 CGACATCAGTGGTTCTCAACGGG - Intergenic
989530446 5:42501719-42501741 CTAGAGTAGTGTTTCTCACCAGG - Intronic
989620160 5:43376259-43376281 CTAGACCAGTTGTTTTCAACTGG + Intergenic
990026415 5:51196400-51196422 CTATGTCAGTGGTTCTCAACTGG + Intergenic
990166881 5:53004190-53004212 TTAGTGCAGTGGTGCTCAACTGG - Intronic
990371750 5:55126646-55126668 CTAAATCACTAGTTCTCAAAGGG + Intronic
990386616 5:55270175-55270197 CTAGACTAGTAGTTCTCAACTGG - Intronic
990609694 5:57444805-57444827 CTAGAGCAGTGGTTCTCAGCTGG - Intergenic
990676475 5:58191928-58191950 CTGGAACAGTGGTTCTTAACTGG + Intergenic
990858185 5:60295672-60295694 TTAGCTCAGTGGTTCTCAACTGG - Intronic
990914032 5:60883353-60883375 CTTGATCAGTGGGTCTCAAATGG - Intronic
991023710 5:62007752-62007774 CTAGATCAGTGTTTCTCAACTGG - Intergenic
991061869 5:62384601-62384623 CAATAACAGTGGCTCTCAACTGG - Intronic
991196252 5:63935910-63935932 TTGGATCAGTGGTTCTCAACTGG - Intergenic
991369802 5:65906440-65906462 GTAAATCAGTGGTTTCCAACTGG + Intergenic
991380138 5:66012955-66012977 CTAAACCAGTGGTTCTCAACTGG + Intronic
991466158 5:66914724-66914746 CTAGGACAGTGGGTCTCAACTGG + Intronic
991605104 5:68393356-68393378 GTAGAGCAGTGATTCTCAACTGG + Intergenic
991632949 5:68675091-68675113 TTTGCCCAGTGGTTCTCAACTGG + Intergenic
992007342 5:72490816-72490838 CAAGTTCAGTAGTTCTCAACTGG - Intronic
992028556 5:72696589-72696611 CTAGGTCAGTGGTTCTCAATGGG - Intergenic
992045551 5:72884922-72884944 CTAGAGTAGTGGCTCTAAACTGG - Intronic
992280438 5:75169969-75169991 CTGAGGCAGTGGTTCTCAACTGG - Intronic
992515688 5:77490429-77490451 TTTAAGCAGTGGTTCTCAACTGG - Intronic
992791279 5:80216346-80216368 CTAACTCAGTGGCTCTTAACTGG - Intronic
992995420 5:82327987-82328009 TTATGTCAGTGGTTCCCAACTGG - Intronic
993071771 5:83173741-83173763 CTAGTTAGGTTGTTCTCAACTGG - Intronic
993348373 5:86814774-86814796 CCAAAGCAGTGGTTCTCAACTGG - Intergenic
993509542 5:88754524-88754546 CTAGAACACTGGTACTCTACAGG + Intronic
994848161 5:105017333-105017355 CTAAATCAGTGGTTCTAAGTTGG - Intergenic
995050741 5:107700035-107700057 CTGGAGAAATGGTTCTCAACTGG - Intergenic
995441184 5:112193876-112193898 TTAACCCAGTGGTTCTCAACTGG - Intronic
995502079 5:112818153-112818175 ATAAGTCAATGGTTCTCAACTGG - Intronic
995596626 5:113754277-113754299 CTACATCAGTGGTTTTCAACTGG - Intergenic
995658212 5:114450692-114450714 CTAGGCCAGTGGTTCAGAACAGG + Intronic
995732058 5:115256095-115256117 TGAGAACAGTGGTTCTCTACTGG + Intronic
995744378 5:115388495-115388517 CTGAATCAGTGGTTTTCAGCAGG - Intergenic
995837971 5:116416853-116416875 ATATCCCAGTGGTTCTCAACTGG + Intergenic
995913519 5:117215899-117215921 CTATATCAGTGGTTTTCAACTGG + Intergenic
996312505 5:122122699-122122721 CTGGATCAGTGATTCTTAAATGG - Intergenic
996869642 5:128174248-128174270 CTGGATCAGAGATGCTCAACTGG - Intronic
996947359 5:129086338-129086360 GTAGAGAAGTGGTTCTCAGCCGG - Intergenic
997221990 5:132176859-132176881 CTTTAGCAGTGGTTCTCAGCTGG - Intergenic
997638507 5:135433078-135433100 TTAACTTAGTGGTTCTCAACCGG - Intergenic
997783126 5:136679854-136679876 TTAGAACAGTAGTTCTCAACTGG - Intergenic
998189045 5:140006993-140007015 CTAGAATAGTGGTCCTTAACTGG + Intronic
998497250 5:142601530-142601552 TGAGAACAGTGGTTCTCAACTGG + Intronic
998573327 5:143285303-143285325 ATAGATCAGTGGTTCTCAAAAGG + Intronic
998585263 5:143420542-143420564 CTAGAACACTAGTTTTCAACTGG + Intronic
998843174 5:146277964-146277986 CTAAAGCAGTGGTTCTCAATTGG - Intronic
998855472 5:146390727-146390749 TTAGAAAAGTTGTTCTCAACTGG - Intergenic
998880149 5:146637253-146637275 CTAGATCAGTGGTTCTCAACTGG + Intronic
998946667 5:147347401-147347423 CTAAAGTAGTGATTCTCAACTGG + Intronic
999057611 5:148596703-148596725 CTAGAGCAGTACTTCTCAACTGG - Intronic
999062486 5:148651437-148651459 TTACAGCAGTGGTTTTCAACTGG + Intronic
999226014 5:150025345-150025367 TTGTATCAATGGTTCTCAACTGG + Intronic
999412216 5:151360826-151360848 GGAGATGAGTGCTTCTCAACCGG - Intergenic
999417410 5:151410972-151410994 TTAGACCAGTGGTTCTTAATTGG - Intergenic
999482529 5:151961835-151961857 TTATACCAGTGGTTCTCCACTGG + Intergenic
999486307 5:152000211-152000233 CTATGGCAATGGTTCTCAACTGG + Intergenic
999529390 5:152445735-152445757 CTAAATCGGTGTTTCTGAACAGG + Intergenic
999626386 5:153525181-153525203 CTAGTGCAGTGATTCTCAGCTGG + Intronic
999626681 5:153528609-153528631 TTAGCTCAGTGATTCTCAAAAGG - Intronic
999647626 5:153734941-153734963 CTAACTTAGTGGTTCTCAACTGG + Intronic
999653016 5:153785702-153785724 TTAAATCAGTGGTTCCCAAACGG - Intronic
999783862 5:154873786-154873808 CTAGGTCAGTGATTCTCAACTGG + Intronic
999813304 5:155149669-155149691 TCAGATCAGTGGCTCTCTACGGG + Intergenic
999821437 5:155232950-155232972 CTAGCCCAGTGGTCCTCAACTGG + Intergenic
999840668 5:155422384-155422406 CTAGATCAGTTGTTCTCAACAGG - Intergenic
999854364 5:155577717-155577739 TTAAATTAGTGGTTATCAACTGG - Intergenic
999930131 5:156422848-156422870 TTACATCAGTGGTTCTCAACTGG - Intronic
1000054653 5:157594498-157594520 TAAGATCAGTGGTTCTCAAAGGG - Intergenic
1000124169 5:158227161-158227183 GTAGATCAGTGGTTTTCAACTGG + Intergenic
1000307601 5:160009545-160009567 CTACAGCAGTGGTTCGCAATTGG + Intronic
1000336720 5:160246766-160246788 TTATATCAGTGATTCTCAACAGG - Intergenic
1000363763 5:160472268-160472290 CCAGAGCAGTGGTTCTCAACTGG - Intergenic
1000397141 5:160787820-160787842 CTAGATCAGAAGTTATAAACTGG + Intronic
1000398660 5:160802374-160802396 CTATATCAGTGGTTCTCAACTGG + Intronic
1000563071 5:162814402-162814424 CTAGAACAGTGGTTCCCAGCTGG - Intergenic
1000577391 5:162991183-162991205 CTAGATCAGTGGTTTTCAACTGG + Intergenic
1000904850 5:166952667-166952689 ATAGAGCAGTGGTTCTCAACTGG - Intergenic
1000986695 5:167868278-167868300 CTAGCTCAGTCATTCTCCACTGG - Intronic
1001019594 5:168172026-168172048 CCAGACCAGTGGTTCCCTACCGG + Intronic
1001072563 5:168599654-168599676 CTAAAGCAGTGGTTTGCAACTGG - Intergenic
1001079946 5:168660397-168660419 CGATAGCAGAGGTTCTCAACTGG - Intergenic
1001089090 5:168723912-168723934 TTAGAGCAGTGATTCTTAACTGG + Intronic
1001127064 5:169029329-169029351 CTAGTTCATTTGTTCTCAAAGGG + Intronic
1001139384 5:169131448-169131470 CTAATTTAGTGGTTCTCATCTGG - Intronic
1001404637 5:171467283-171467305 CCGGATCAGTGGTTCTCACCTGG + Intergenic
1001435984 5:171699744-171699766 TTAGAACAGTTGTTCTCAACTGG - Intergenic
1001454538 5:171850650-171850672 TTAAAGCAGTGGTTCTCAATGGG + Intergenic
1001461480 5:171918900-171918922 CTAGAGCACTGGTTTTCAAGTGG - Intronic
1001615415 5:173039912-173039934 CTACACCAGTGCTTCTCAAATGG + Intergenic
1001777670 5:174341075-174341097 ATAGATCAGTGTTTCCCAATTGG + Intergenic
1001857228 5:175023467-175023489 TTAAGGCAGTGGTTCTCAACCGG - Intergenic
1002166526 5:177351154-177351176 CCAGGTGAGTGGTTCTCAAGAGG - Exonic
1002720045 5:181253478-181253500 CTACATCAGTGGTTCTCAACTGG + Intergenic
1003030547 6:2597023-2597045 CTGGTGCAGTGGTTCTCAGCCGG - Intergenic
1003034106 6:2628219-2628241 TTAAGTCAGTGGTTCTCAACTGG + Intronic
1003079202 6:3007308-3007330 CTACACCAATGGTTCTCAACTGG - Intronic
1003158208 6:3614472-3614494 CTAAAATAGTGGTTCTCAACTGG + Intergenic
1003404708 6:5818791-5818813 CAAGATCAGTGGTTGCCAAGGGG - Intergenic
1003442327 6:6154592-6154614 CTATACCAGTGGTTTCCAACTGG - Intronic
1003501631 6:6708002-6708024 GTAGATCAGTGACTCTTAACCGG - Intergenic
1003829797 6:9995269-9995291 TTATACCAGTGATTCTCAACTGG - Intronic
1004310887 6:14543935-14543957 CTAAAGCAGTGGTCCTCAACTGG - Intergenic
1004415223 6:15417182-15417204 CGAGAACAGTGGTTCTTAAGCGG + Intronic
1004777662 6:18866122-18866144 CTAGACCAATGGTTCTCATGTGG - Intergenic
1004853373 6:19724279-19724301 CTAGAGCAGTTGTTCTAACCTGG + Intergenic
1004925984 6:20415567-20415589 CTAGTTCGGTGGTTCTCAGCTGG - Intronic
1004927407 6:20428946-20428968 GTAGACCAGTGGTTCTCAACTGG + Intronic
1005112822 6:22302984-22303006 CTAAATGAGTGGTTTTCAAAGGG + Intergenic
1005139573 6:22612746-22612768 CTATGTCAGTGACTCTCAACTGG + Intergenic
1005354470 6:24969226-24969248 CCAAATCGGTGGTTCTCACCTGG - Intronic
1005673853 6:28134297-28134319 ATAGAGCAGGGGTTCTCAACTGG - Intergenic
1006331484 6:33394186-33394208 ATAAACCAGTGGTTCTCAACTGG - Intronic
1006574742 6:35036778-35036800 TTACAGCAGTGGTTCTCAAAGGG + Intronic
1006817777 6:36864565-36864587 CTAGCCTAGTGGTTCTCAACGGG + Intronic
1006954152 6:37852183-37852205 CTAGGTAAGTGGTTCTCCATGGG + Intronic
1007025310 6:38565425-38565447 TGGGAACAGTGGTTCTCAACTGG - Intronic
1007048810 6:38804806-38804828 CTGGAACAGTGGTTCTTAATGGG + Intronic
1007093425 6:39198940-39198962 CTGGAACAGGGGTTCTCCACTGG + Intronic
1007119424 6:39367833-39367855 TTGGTTCAATGGTTCTCAACTGG + Intronic
1007310296 6:40940046-40940068 CAAGATGAGTGGTTCTCAGTTGG + Intergenic
1007502649 6:42310459-42310481 GTGGAGCAGTAGTTCTCAACAGG + Intronic
1007512314 6:42382961-42382983 ACAAAGCAGTGGTTCTCAACTGG - Intronic
1007688949 6:43685550-43685572 CTAAAACAGTGATTTTCAACTGG - Intronic
1007914906 6:45552374-45552396 CTAGCTAAGTGGTTCTCAATCGG - Intronic
1007993266 6:46279560-46279582 ACAGAGCAGTGCTTCTCAACAGG - Intronic
1008129673 6:47706487-47706509 ATAGGACAGTGGTTCTCAACTGG + Intronic
1008158615 6:48049093-48049115 CCAGAGCAGTGGTTCTCAACAGG + Intronic
1008401127 6:51064322-51064344 CTAGAATAGTAGTTCTCAACTGG - Intergenic
1008418235 6:51267876-51267898 CTAGTTCAGTGGTTCTGAATTGG - Intergenic
1008434106 6:51455023-51455045 CTAGATCACTAGTTCTTTACTGG + Intergenic
1008618270 6:53246878-53246900 GTATACCAGTGGTTCCCAACTGG - Intergenic
1008762403 6:54868386-54868408 CAAGTTCAGTGGTTCTCAAAAGG - Intronic
1008920515 6:56839565-56839587 CTAGCTCAGTGGTTTTCATTTGG - Intronic
1008968681 6:57341205-57341227 CTAGTTCAGTGATTCTCAGTGGG + Intronic
1009157663 6:60243023-60243045 CTAGTTCAGTGATTCTCAGTGGG + Intergenic
1009730843 6:67604341-67604363 TTCGGTCAGTGATTCTCAACTGG + Intergenic
1009892281 6:69700581-69700603 CTAGAGCAGTGGTTCTTAAATGG - Intronic
1009963066 6:70547606-70547628 CTAAAGCAGTGGTTCTAAACTGG - Intronic
1010374490 6:75150899-75150921 CTAATGCAGTGATTCTCAACTGG + Intronic
1010392773 6:75356075-75356097 CTAGAACAGTGGTTCTCAATTGG - Intronic
1011026342 6:82873447-82873469 CTACATCAGTGGTTTTCCAGGGG + Intergenic
1011026827 6:82878601-82878623 CTAGGTCAGGGGTTCTCAGTGGG + Intergenic
1011028060 6:82891182-82891204 CCATAGCAGTGGTTCTCAGCTGG + Intergenic
1011184085 6:84654976-84654998 CTAGAGAAGTGGTTCTCAGAGGG + Intergenic
1011388095 6:86819499-86819521 CTAAATCAGTGGTTCTCAATTGG + Intergenic
1011431039 6:87287129-87287151 TTAAAGCAGTGGCTCTCAACTGG - Intronic
1011552817 6:88545492-88545514 CTAGCTCAGTGGTTCTCAACAGG + Intergenic
1011574753 6:88783866-88783888 TTAGATCAGTGATTCTCAACTGG - Intronic
1011614017 6:89181574-89181596 CTACAACAGTGTTTCTCAAATGG - Intronic
1011776023 6:90731483-90731505 CTAACTCAGTGGTTCTCAACTGG - Intergenic
1011808346 6:91099139-91099161 CTGCATCAGTGGTTCTTAGCTGG + Intergenic
1011998345 6:93621733-93621755 CTATTTCAGTGGATCTTAACTGG + Intergenic
1012158359 6:95849662-95849684 CTGAAGCAGTGGCTCTCAACTGG - Intergenic
1012195751 6:96340029-96340051 CTAATGCAGTGGTTCTTAACTGG - Intergenic
1012272181 6:97226964-97226986 CTAGTTCAGTAGTTCTCAACTGG - Intronic
1012642774 6:101640796-101640818 CTAGATCAGTGATTCTCAAGTGG - Intronic
1012858288 6:104528566-104528588 TGAGAACAGTGGTTCTCAACAGG - Intergenic
1013109944 6:107056918-107056940 CTAATGCAGTGGTTCTCAACTGG - Intergenic
1013152225 6:107457631-107457653 CTAGAGCACTGGTTCTCAACTGG - Intronic
1013404796 6:109832951-109832973 CTAACTCAGTGTTTCTCAAATGG + Intergenic
1013603026 6:111722611-111722633 TTACAGCAGTGGTTCTCAGCTGG + Intronic
1013609103 6:111777648-111777670 ATAGAGCAGTGGTTTTCAACTGG - Intronic
1013656368 6:112251034-112251056 TGAGAACAGTGATTCTCAACAGG - Intronic
1013767498 6:113591991-113592013 CTAGACCAATTATTCTCAACTGG - Intergenic
1013852046 6:114527920-114527942 TTAGATCAGTGTTTCCTAACTGG + Intergenic
1014102080 6:117522379-117522401 CTAGACTAGTGGCTCTCCACTGG - Intronic
1014119769 6:117711503-117711525 CTAGTGCAGTGGTTCTCACCTGG + Intergenic
1014125471 6:117772046-117772068 CTAGGGCAATTGTTCTCAACAGG - Intergenic
1014412018 6:121136370-121136392 TTATAGCAGTGGTTCTCAAGTGG + Intronic
1014491168 6:122063933-122063955 CTAGACCAGTGCTTCTCAATAGG + Intergenic
1014818332 6:125958646-125958668 ACAGGTCAGTGATTCTCAACTGG + Intronic
1015054350 6:128882397-128882419 CTAGGTCAGTGGTTCTCATAAGG - Intergenic
1015189687 6:130459282-130459304 CTATAGCCGTAGTTCTCAACTGG + Intergenic
1015252336 6:131140126-131140148 CTGGAGCAGTGGTTTTCAATTGG + Intronic
1015638771 6:135307775-135307797 ATATAGCAGTGGTTCTCAACTGG + Intronic
1015830300 6:137361849-137361871 TTAGAACAATGGTTCTTAACTGG + Intergenic
1015876620 6:137828942-137828964 CCTCAACAGTGGTTCTCAACTGG + Intergenic
1015891541 6:137974762-137974784 CTAAAACACTGGTTCTCAAATGG + Intergenic
1015897691 6:138033214-138033236 CTGGAGCAGTGTTTCCCAACTGG + Intergenic
1016469353 6:144359325-144359347 TTATATCAGGGGTTCTCAGCTGG - Intronic
1016571157 6:145514614-145514636 ATAGAGCAGTGTTTCTCAACTGG + Intronic
1016592478 6:145761852-145761874 CTAGAGCAGTGATTCTCAATAGG - Intergenic
1016673083 6:146731176-146731198 GTAGGTGAGTAGTTCTCAACTGG - Intronic
1016696309 6:147000170-147000192 CTAGACTAGCCGTTCTCAACAGG + Intergenic
1017183541 6:151577322-151577344 CTAAGACAGTGGTTTTCAACTGG - Intronic
1017256619 6:152340596-152340618 CTAGCGCAGTGGTTCACAACTGG - Intronic
1017629130 6:156379164-156379186 TTGGGCCAGTGGTTCTCAACTGG - Intergenic
1017759290 6:157555869-157555891 TTACAGCAGTGGTTCTCTACTGG - Intronic
1018047052 6:159974792-159974814 GTAGGCCAGTGGTTCTCAATTGG - Intronic
1018157740 6:161004166-161004188 CCAGGCCAGTGGTTTTCAACTGG - Intronic
1018166430 6:161101798-161101820 CTAGAGCAATAATTCTCAACTGG - Intronic
1018249521 6:161854786-161854808 CTAGAAAAGTGGTTCTCGGCCGG + Intronic
1018376581 6:163218814-163218836 ATAGCCCAGTGGATCTCAACAGG + Intronic
1018431808 6:163728820-163728842 CTAGCCCAGTGGTTCTCAACTGG + Intergenic
1018591089 6:165423523-165423545 CTAGGTCAGTGCTTCTCAATAGG - Intronic
1019653904 7:2177275-2177297 CTAGGCCACTGGTTCTCAAGTGG + Intronic
1019880285 7:3853605-3853627 CCAGATTAGGGGTGCTCAACTGG - Intronic
1019947545 7:4342029-4342051 CTGGAGCAGTGGTTCTCCACAGG + Intergenic
1020477647 7:8617017-8617039 TGAGAGCAGTGGTTCTCAACTGG + Intronic
1020506314 7:8993183-8993205 TTACAGCAGTGGTTCCCAACTGG - Intergenic
1020911473 7:14137223-14137245 CTAGAGCAGCAGTTCTGAACAGG + Intergenic
1020930296 7:14384700-14384722 TTACCTCCGTGGTTCTCAACTGG + Intronic
1021206144 7:17783472-17783494 CTAAATCAGTAGTTTTCAACTGG - Intergenic
1021248602 7:18295720-18295742 GTAGACCAGTAGTTCTCAACCGG + Intronic
1021339381 7:19444672-19444694 TTAGAACAGTGGTTCTCATCTGG + Intergenic
1021799254 7:24287589-24287611 CTAAATCAGTGGTTCTCAACTGG + Intronic
1021882576 7:25108851-25108873 GTAGCCCAGTGGTTCTCAACTGG - Intergenic
1021936245 7:25635046-25635068 CTAAAGCAGTGGTTCTCAACCGG + Intergenic
1021940353 7:25672957-25672979 CTTGCTCAGTGGTTCTCAGCTGG + Intergenic
1022331748 7:29385717-29385739 TTAGGCCAGTGGTTCTCAACTGG - Intronic
1022524907 7:31030622-31030644 CTAGAACAATGATTCTCAATCGG + Intergenic
1022626330 7:32040516-32040538 CTAAGCCAGTGGTTCTCGACTGG - Intronic
1022663820 7:32390307-32390329 CTAAAGCAGTGATTCTCAACTGG + Intergenic
1022757621 7:33310612-33310634 CTAGCTCCCTGGTTCCCAACTGG + Intronic
1022769959 7:33459268-33459290 CTAGAGCTGTGGTTCTCAATTGG + Intronic
1023041338 7:36175754-36175776 CTGGAGCAGCGGCTCTCAACTGG - Intronic
1023082423 7:36537886-36537908 CTAGGCCAGTGGTTCTCAACTGG - Intronic
1023225493 7:37964783-37964805 CTAGAGCAGTGGATCTCAAACGG + Intronic
1023564991 7:41515398-41515420 CTAGATAAATGGTTATAAACAGG - Intergenic
1023576558 7:41634560-41634582 TTAGGGCAGTGGTTTTCAACTGG - Intergenic
1023583709 7:41707291-41707313 CTACAGCAGTGGTTCTCAACCGG + Intergenic
1023980901 7:45069379-45069401 CTAAAGCAGAGGCTCTCAACTGG - Intronic
1024678927 7:51663057-51663079 CTAAAGCAGTGGTTATCAAGTGG + Intergenic
1024924551 7:54599329-54599351 TTAGAGCAGTGGTTCTCAACTGG + Intergenic
1026065972 7:67073175-67073197 TTAAATCAGTGGTTCTCAACTGG + Intronic
1026348442 7:69495038-69495060 CCAGGACAGTGGCTCTCAACTGG - Intergenic
1026427279 7:70308695-70308717 TTAGAACAGTAGTTCTCAACTGG + Intronic
1026564231 7:71476594-71476616 CTAGGCCAGTGGTTTTCAAGGGG + Intronic
1026710907 7:72738675-72738697 TTAAATCGGTGGTTCTCAGCTGG - Intronic
1027130945 7:75590975-75590997 CTAAAGTAGTAGTTCTCAACTGG + Intronic
1027433064 7:78134166-78134188 ATAAAACAGTAGTTCTCAACGGG - Intronic
1027546505 7:79533319-79533341 CTAGTTCTGTGGTTCTCAATTGG - Intergenic
1027820906 7:83043189-83043211 TTAAAGCAGTGGTTATCAACTGG - Intronic
1028061556 7:86324314-86324336 CCACAGCAGAGGTTCTCAACTGG - Intergenic
1028064399 7:86364102-86364124 GCAGAGCAGTGGTTCTCAACTGG + Intergenic
1028125140 7:87104298-87104320 CTAGATCAGTGATTCTCAAAGGG - Intergenic
1028243156 7:88445739-88445761 CTAGATCAGTGGTTCTTAGTGGG + Intergenic
1028665633 7:93340812-93340834 CTGAATCAGTGGTTCTCTCCTGG + Intronic
1028710552 7:93902996-93903018 ATAGATCCCTGGTTCTCAATGGG - Intronic
1028884317 7:95913963-95913985 CAAGATCAGAGCTTCTCACCTGG - Intronic
1029074503 7:97925370-97925392 GTAGACCAATGGCTCTCAACTGG + Intergenic
1029410406 7:100406167-100406189 CTAACCCAATGGTTCTCAACCGG + Intronic
1029782926 7:102753615-102753637 ATAAAGCAGTCGTTCTCAACTGG - Intronic
1030014621 7:105206236-105206258 CTAGTGCACTGGTTCTCAATGGG - Intronic
1030045417 7:105490794-105490816 CTAGACCAGTGGTTCCCAATCGG + Intronic
1030135108 7:106239146-106239168 ATAGAGCAGCGGTTCTCTACTGG + Intergenic
1030266008 7:107622642-107622664 GTAAATCAGTAGTTCTCAACAGG + Exonic
1031041367 7:116841745-116841767 CTAAATCAGTGATTCTCAAAGGG + Intronic
1031133319 7:117858549-117858571 CTTGGCCAGTGGTTCTCCACAGG + Intronic
1031192099 7:118565833-118565855 CTATATCAGTGGTTCTCCATTGG - Intergenic
1031420078 7:121541168-121541190 CTAGGCCAATGGTTTTCAACTGG + Intergenic
1031498525 7:122482233-122482255 GTAATTCTGTGGTTCTCAACTGG + Intronic
1031875869 7:127140374-127140396 ATAGAACAGTGTTTCTCAACTGG - Intronic
1032162895 7:129524188-129524210 CCAGATCAATGGCTCTCAACGGG - Intergenic
1032345569 7:131113467-131113489 ATTCATCAGTGGTTCTCCACTGG - Intronic
1032433054 7:131878613-131878635 CCAGGACAGTGGTTCTCAACAGG - Intergenic
1032698947 7:134361936-134361958 TTAGAACAGTGGTCCTCAGCTGG - Intergenic
1032742569 7:134753577-134753599 CTAGACCAGTGCTTCTTACCTGG - Intronic
1032807167 7:135367182-135367204 TTGTGTCAGTGGTTCTCAACTGG - Intronic
1032887283 7:136154423-136154445 ATTCACCAGTGGTTCTCAACTGG + Intergenic
1033073456 7:138226046-138226068 GCGGAACAGTGGTTCTCAACTGG - Intergenic
1033166711 7:139045249-139045271 CTAGTTCAGTGGTTTTCAATGGG - Exonic
1033820621 7:145130336-145130358 CTATACCAGTTGTTCTCAACAGG - Intergenic
1034059466 7:148073146-148073168 TTAGACCAGTGATTTTCAACTGG - Intronic
1034587694 7:152110115-152110137 TTAGACCAGTGGCTCTCAACTGG - Intronic
1034593051 7:152160251-152160273 CTAGTTCTGTGGCTCTCAAGGGG + Intronic
1034612212 7:152381258-152381280 CTAGAACAATGGTTCTTAACTGG + Intronic
1034988248 7:155530929-155530951 CTATGCCAGTGGTTCTCAACTGG - Intronic
1035014420 7:155752663-155752685 TTAGACCAGTGGTTCTCACAGGG - Intronic
1036188453 8:6646816-6646838 TTAGGTCAATGGTTCTCAACTGG - Intergenic
1036258846 8:7225143-7225165 GTAGACCAATGGCTCTCAACTGG + Intergenic
1036309645 8:7676742-7676764 GTAGACCAATGGCTCTCAACTGG + Intergenic
1036310901 8:7683739-7683761 GTAGACCAATGGCTCTCAACTGG + Intergenic
1036616101 8:10388947-10388969 CTAGTTCAGTGATTCTCAACTGG - Intronic
1036616314 8:10390380-10390402 CTAGGTCAGTGGTTCTCAACTGG - Intronic
1036829524 8:12011272-12011294 GTAGACCAATGGCTCTCAACTGG + Intergenic
1036898625 8:12655511-12655533 GTAGACCAATGGCTCTCAACTGG + Intergenic
1036920103 8:12844237-12844259 CTAGAGCAGTGGTTCTCAGAGGG - Intergenic
1037340463 8:17839173-17839195 CTAGAACAGTGGTTCTTGGCCGG - Intergenic
1037342626 8:17862813-17862835 CTAAATCAGTGTTTCCCAAGCGG - Intergenic
1037408149 8:18565779-18565801 CTAAAGCAGTGGTTCTCAATAGG + Intronic
1037536151 8:19826692-19826714 CTAAGTCAGTGGTTCTCCACTGG + Intronic
1037573824 8:20181720-20181742 CTACATCAGTGTTTCTCAGTGGG - Intronic
1037766177 8:21773785-21773807 TTACAGCAGTGCTTCTCAACTGG + Intronic
1037853224 8:22349957-22349979 TTAGTGAAGTGGTTCTCAACTGG + Intronic
1038159008 8:25019019-25019041 TTAGCCCAGTGGTTCTCAACAGG - Intergenic
1038445639 8:27602140-27602162 CTAGAATAGAGGTTCTCTACTGG + Intronic
1038500255 8:28037792-28037814 CTAGACCAGTGATTCTCAACCGG + Intronic
1038624412 8:29177043-29177065 TTAGACCAGTGGTTCTCAACTGG + Intronic
1040436284 8:47394437-47394459 CTAGGATAGTGGTTCTCAACTGG + Intronic
1041267471 8:56078878-56078900 CTACAATAGTGGCTCTCAACCGG - Intergenic
1042110560 8:65377125-65377147 AAAAACCAGTGGTTCTCAACTGG - Intergenic
1042349213 8:67760245-67760267 TTAGTTCAGTGGTTCTCAGATGG + Intergenic
1042518436 8:69684201-69684223 CTAGACTAGTGGGTCTCCACTGG + Intronic
1042559936 8:70065853-70065875 CTAGAGCAGTGTTTTTCAAATGG - Intronic
1042653353 8:71067398-71067420 TTAAACCAGTGGTTCTCAACAGG - Intergenic
1042662351 8:71168879-71168901 CTACATCAGTGGTTCTCAAAGGG + Intergenic
1043059418 8:75481046-75481068 TTAGATCACTGGTTTTCAAACGG + Intronic
1043291375 8:78605718-78605740 CTAGATCAGTGGTTCTAAAGTGG - Intergenic
1043531512 8:81156459-81156481 GTTGCACAGTGGTTCTCAACTGG + Intergenic
1043534334 8:81185452-81185474 CTAACTCAGTGGCTCTCAACTGG + Intergenic
1043838291 8:85069421-85069443 CTAGACCAGCAGTTCTCAAAGGG + Intergenic
1044075705 8:87819952-87819974 CTATGTCAGTAGTTTTCAACTGG - Intergenic
1044272035 8:90256633-90256655 CTAGAGAAGTGGTTCTAAACTGG - Intergenic
1045552766 8:103187262-103187284 TGAGAGCAGTGGTTCTCAACTGG + Intronic
1045571671 8:103373788-103373810 ATATATCAGTGGATCTCAACTGG - Intronic
1045815697 8:106273385-106273407 TTAGAGCAGTGATTCTCCACTGG + Intronic
1045899905 8:107265161-107265183 CTAGATCAGTGGCCCTCTAATGG + Intronic
1045908068 8:107372290-107372312 TTATATCAGTAGTTCTCAGCTGG - Intronic
1045912044 8:107421953-107421975 CTATAGCAGTGGTTCACAAATGG - Intronic
1046567439 8:115919304-115919326 TTACAGCAGTGGTTCTCAACTGG + Intergenic
1046608864 8:116402254-116402276 CTTGACCAGTGGTTCTCAATTGG - Intergenic
1046771296 8:118119015-118119037 CTAGATTAGTGGGTCTCAACTGG - Intergenic
1046779840 8:118203302-118203324 TTAGAGCACTGGTTCTCAACTGG + Intronic
1047179055 8:122569761-122569783 GTAGAGCAGTGGCTTTCAACAGG - Intergenic
1047187723 8:122649375-122649397 CCATATCAGTGGTTGTCAACTGG - Intergenic
1047191770 8:122684924-122684946 CTAAATCTGTGGTTCTCAGTTGG + Intergenic
1047199918 8:122756258-122756280 CTTCATCAGTGGATCTGAACTGG + Intergenic
1047311138 8:123693076-123693098 TTACAACAGTGGTTCTCAATTGG - Intronic
1047318806 8:123759363-123759385 CTAAACCAGTAGTTCTCAACTGG - Intergenic
1047482552 8:125298639-125298661 CGTGACCAGTGGTTCTTAACAGG + Intronic
1047564747 8:126031767-126031789 CTAGAGCAGTGGTTATCAACCGG - Intergenic
1047693765 8:127383178-127383200 TGAAATCAGTGGCTCTCAACTGG - Intergenic
1047846722 8:128814181-128814203 CAAGATCAATGGTTCACAAATGG + Intergenic
1047905966 8:129473729-129473751 CTAGGCCAGTGGTTCTCAGCTGG + Intergenic
1048077508 8:131088573-131088595 TTAGGTCAGTGTTTCTCAATTGG + Intergenic
1048143555 8:131819826-131819848 TTAGATCTGTGATCCTCAACTGG + Intergenic
1048339041 8:133524933-133524955 CTAGATCTGGGCTTCCCAACGGG + Intronic
1048384188 8:133896224-133896246 CTAGGTTAATGGTTCCCAACTGG + Intergenic
1048713630 8:137242290-137242312 CTAACTCAGTGCTTCTCAACTGG - Intergenic
1049118298 8:140709844-140709866 CTAAACCAGAGGTCCTCAACTGG + Intronic
1049623304 8:143608981-143609003 ATAAAGCAGTGTTTCTCAACAGG + Intronic
1049928713 9:434999-435021 TTAGAGCAGTGGTTCTCAACTGG + Intronic
1050113140 9:2237268-2237290 CTAGATCATGGATTCTCAACAGG + Intergenic
1050623234 9:7476504-7476526 CTGGAGCAGTGTTTCTCAAATGG - Intergenic
1050669100 9:7976297-7976319 CTAGATGAGTGGTTTCAAACTGG - Intergenic
1050732217 9:8721936-8721958 CAACATCAGTGGTTCTCAATTGG + Intronic
1050765300 9:9125651-9125673 TTAGATCAGTGATTCTCACCTGG - Intronic
1050844696 9:10200290-10200312 ATAGATCAGTGGTTTTCAACTGG + Intronic
1051112849 9:13659474-13659496 CTAGATCAGTGATTTTTAAGTGG + Intergenic
1051229648 9:14942459-14942481 CTAGACCTGCGGTTCTCAACAGG - Intergenic
1051235696 9:14996289-14996311 CTAGAGCAGTGGTTCTCAACTGG - Intergenic
1052303883 9:26983380-26983402 CTAGAGCAGTGGTTCTCAACTGG + Intronic
1052810699 9:33056509-33056531 TGAGATCAGTGGGTCTCAGCTGG + Intronic
1052871095 9:33507353-33507375 GTAAAGCAGTGGTTCTTAACTGG - Intergenic
1053052477 9:34973120-34973142 CTAGCTCAGAGGTTCTCTACCGG - Intronic
1053192358 9:36083124-36083146 ATAGTCCAGTGGTTCTCCACAGG - Intronic
1054778685 9:69146655-69146677 TTAGGTCAGTGGTTGTCAACGGG + Intronic
1054897534 9:70330366-70330388 TTAGACCAGTGGTTCTCAACTGG - Intronic
1054923863 9:70568834-70568856 CTGGGTCAGTGGCTGTCAACTGG + Intronic
1055106951 9:72523042-72523064 CTAACCCAGTGGTTTTCAACTGG - Intronic
1055144464 9:72916204-72916226 CTAGAGCAGTGATTCTAAACTGG - Intronic
1055275352 9:74609793-74609815 CTAGAACAGTGGTTGTCAACTGG + Intronic
1055312126 9:74993602-74993624 TTGGAGCAATGGTTCTCAACTGG + Intronic
1055431558 9:76249090-76249112 CTAGATCACTGATTTTCAACTGG + Intronic
1055482886 9:76727214-76727236 CTAAAGCAGTGGTTCTTAACTGG - Intronic
1055565624 9:77565916-77565938 ATACATCAGTTGTTCTCAATGGG + Intronic
1055628575 9:78199825-78199847 CTAGATCAGTGTTTCCCAAAGGG + Intergenic
1055645131 9:78356050-78356072 GTAGAAGAGTGTTTCTCAACAGG + Intergenic
1055696126 9:78886613-78886635 TTACATCAGTTGTTCTGAACAGG + Intergenic
1055704286 9:78980540-78980562 ATAGGTCAGGGGTTCTCAAAGGG - Intergenic
1055759215 9:79588931-79588953 CTAGAGCAGTGGTTGCAAACTGG + Intronic
1055936331 9:81607780-81607802 CTAGTTCATGGGTACTCAACTGG + Intronic
1056172873 9:84005159-84005181 ACAGAACAATGGTTCTCAACTGG - Intergenic
1056261287 9:84851199-84851221 CTAGGTCAGTGGTTCTCAAACGG - Intronic
1056370316 9:85947555-85947577 TTAGATTAGTGGTTCTCAACTGG + Intronic
1057149808 9:92786243-92786265 CTAAACCAGTGGTTCTCAACTGG - Intergenic
1057237974 9:93380948-93380970 CTAGAGAAGTGATTCTCAACAGG - Intergenic
1057401801 9:94729798-94729820 CTATGGCAGTGGTTCTCAATTGG - Intronic
1057734235 9:97638873-97638895 CTACAGCAGTAGTTCTCAACAGG - Intronic
1057767541 9:97935301-97935323 TTAAATTAGTGGTTCTCAACTGG + Intronic
1058104623 9:100956063-100956085 TTAGAACAATGGTTCTCAACTGG - Intergenic
1058112970 9:101052268-101052290 CTTGATGAGTGGTTTTCAACTGG + Intronic
1058257576 9:102787969-102787991 GTAACTCAGTGGTTCTCAGCTGG - Intergenic
1058428324 9:104895539-104895561 CTAGAGCAGTGGTTCTCGACCGG - Intronic
1058445113 9:105048397-105048419 CTACATCATTGATTCTCAACTGG + Intergenic
1058650122 9:107167791-107167813 CTAGCCCAGTGGTTCTGAACTGG + Intergenic
1058807555 9:108606973-108606995 CTGGAGCACTGGTTCTTAACTGG - Intergenic
1058938933 9:109795253-109795275 CTACATCAGTGATTTTCAAAGGG - Intronic
1059021639 9:110582316-110582338 CTAAAGCAGTGGTTCCCAGCGGG + Intergenic
1059135491 9:111802883-111802905 CTAGACCAGTGGTTCTCAATTGG + Intergenic
1059148563 9:111925600-111925622 CTAGGTCAGTGCTTCTCAACTGG - Intronic
1059214653 9:112549717-112549739 CTAAGTCAGTGGTTCTCAAATGG + Intronic
1059266726 9:113039863-113039885 TTAGATTAGTGGTTCTCAAAGGG + Intronic
1059396456 9:114037018-114037040 CTAGAGCAGTGGTTCTCAAAGGG - Intronic
1059496454 9:114713717-114713739 ATAGACCAGTGGTTCTCACCTGG + Intergenic
1059507986 9:114817292-114817314 CTAGGGCAGTGACTCTCAACTGG + Intergenic
1059520316 9:114934573-114934595 CTAAATCAGTGTTTTTCAAATGG - Intergenic
1059550539 9:115224820-115224842 CTAAATCTGTGATTCTCTACTGG + Intronic
1059759149 9:117321927-117321949 TTACAGCAGTAGTTCTCAACAGG - Intronic
1059788527 9:117613882-117613904 TTATACCAGTGGTTCTCAACTGG + Intergenic
1059795983 9:117697279-117697301 TTAGAATAGTAGTTCTCAACTGG - Intergenic
1059850059 9:118328102-118328124 CTACAACAGTGGTTCTCAACTGG - Intergenic
1059925743 9:119207627-119207649 GTAAATCAGTGGTTCTCACTTGG - Intronic
1060016290 9:120089234-120089256 CTAAAGCAGTGATTCTCAACTGG + Intergenic
1060233383 9:121841901-121841923 AGAGACGAGTGGTTCTCAACTGG - Intronic
1060633683 9:125182854-125182876 CTAGACCAGTCGTTCTCAACTGG - Intronic
1060937882 9:127526523-127526545 CCAGAGTAGTGGTTCTCAACTGG - Intronic
1060955340 9:127634881-127634903 CTAGTCCAGTGGTTCTCAACAGG - Intronic
1061637747 9:131925112-131925134 TTAGGACAGTGGTTCTTAACTGG - Intronic
1185694288 X:2183760-2183782 CTATAGCAGTGATTCTCATCTGG + Intergenic
1185718663 X:2364198-2364220 CTACATCAGTGGTTTTCCATTGG + Intronic
1186013786 X:5167661-5167683 TTAGAGCAGTGGTCCTCAAGTGG - Intergenic
1186152273 X:6687938-6687960 GTAGATGAATGGTTCTCACCTGG - Intergenic
1186173651 X:6903042-6903064 TTAGAGCAGTGATTCTCAAGTGG - Intergenic
1186173784 X:6904277-6904299 GTAGAACAGCTGTTCTCAACAGG + Intergenic
1186202192 X:7165886-7165908 CTAGACCAGTGGTTCTTGCCAGG - Intergenic
1186269961 X:7876228-7876250 CTAACATAGTGGTTCTCAACTGG - Intergenic
1186273433 X:7915224-7915246 CTACAGCACTTGTTCTCAACTGG + Intronic
1186371600 X:8952697-8952719 ATAAACCAGTGGTTCTCCACTGG + Intergenic
1186411659 X:9349265-9349287 TTAAGTCAGTGATTCTCAACTGG - Intergenic
1186514975 X:10160171-10160193 CTCAATCAGTGGTTCTCAACAGG - Intronic
1186522385 X:10217528-10217550 TTAGAGCAATGGTTCTCAACTGG - Intronic
1186582030 X:10830222-10830244 CTAAATCAGAGCTTCCCAACTGG - Intronic
1186601284 X:11040495-11040517 CTAGCTCAGTGGTTCTCAACTGG + Intergenic
1186608208 X:11112753-11112775 CTACATCAGTGGTTCTTAACTGG + Intronic
1186617596 X:11205427-11205449 GCAGGTCAGTTGTTCTCAACTGG - Intronic
1186620803 X:11238051-11238073 ATAGACCAGTGGTTCTCAACTGG - Intronic
1186634609 X:11389008-11389030 ACTGATCAGTGATTCTCAACTGG + Intronic
1186635674 X:11401628-11401650 CTAGCCCTGTGGCTCTCAACTGG - Intronic
1186638878 X:11434002-11434024 CTAGGCCAGTGATTCTCAACAGG + Intronic
1186648598 X:11534593-11534615 CTGTACCAGTGGTTCTCAAAGGG - Intronic
1186670784 X:11765255-11765277 TTAGAGCAGTGGGTCTCAAGTGG - Intronic
1186692516 X:11993517-11993539 CAAGACCAGTGGTTATCAACAGG - Intergenic
1186722085 X:12315789-12315811 CTAAAGGAGTGGTTCTCAACTGG + Intronic
1186762935 X:12742149-12742171 TTAGCCCAGTGGTTCTCAACTGG + Intergenic
1186797060 X:13057252-13057274 CTAAAACAGTGGTTCTTAACTGG - Intergenic
1186803961 X:13120703-13120725 CTGCAGCAGTGGTTCTCAAGAGG - Intergenic
1186819024 X:13267434-13267456 CTATAGCAATGGCTCTCAACTGG + Intergenic
1186821993 X:13298330-13298352 ATAGATCAGTGGTTCTCAACTGG - Intergenic
1186842091 X:13494528-13494550 CTGTATTAGTGGTTCTCAACAGG - Intergenic
1186842150 X:13495020-13495042 ATATATGAGTGGTTCTCAATGGG + Intergenic
1186876619 X:13824251-13824273 CTAAGGCAATGGTTCTCAACTGG - Intronic
1186888917 X:13941016-13941038 CTAGTTCAGGGGTTCTTGACTGG + Intergenic
1186898856 X:14032134-14032156 TTAAAGCAGTGGTTCTCAACTGG - Intergenic
1186900105 X:14045351-14045373 CTATAGCAGTATTTCTCAACTGG + Intergenic
1187007168 X:15243828-15243850 CTAGTTCAGTGGTTCTCCACTGG - Intronic
1187007263 X:15245204-15245226 TTAGGACAGTGGTTCACAACTGG + Intronic
1187011234 X:15282162-15282184 CTAGACCTTTGGCTCTCAACTGG - Intronic
1187029521 X:15471326-15471348 CTATGTCAGTGGTTCTCAACTGG - Intronic
1187040879 X:15594500-15594522 TTATGTCAGTGGTTCTCAACTGG - Intronic
1187079661 X:15973451-15973473 GTAAAGCAGTGGATCTCAACTGG + Intergenic
1187124849 X:16445459-16445481 TTGGATCAGTGGTTTTCAACAGG + Intergenic
1187153671 X:16704476-16704498 AAAGATCAGTGGTTGTCAGCGGG + Intronic
1187241054 X:17513670-17513692 TTCGACCAGTGGGTCTCAACTGG + Intronic
1187280291 X:17853424-17853446 CTAGACAAGTGGTCTTCAACAGG + Intronic
1187305791 X:18094084-18094106 CTAGATCCCAGGTTTTCAACAGG + Intergenic
1187404739 X:18993137-18993159 TTACAGCAGTGATTCTCAACTGG + Intronic
1187418573 X:19114726-19114748 TTAGCATAGTGGTTCTCAACTGG - Intronic
1187722206 X:22162946-22162968 CTAAAGCAGTAGTTCTCAGCTGG + Intronic
1187737225 X:22317156-22317178 TTAAATCAGTGGTTCTCAGCTGG - Intergenic
1187753237 X:22490765-22490787 GTAAGTCAGTGGTTCTCAAAGGG + Intergenic
1187861612 X:23688919-23688941 CTGGAGCAGTGCTTCTCAATGGG + Intergenic
1187971359 X:24662283-24662305 TAGAATCAGTGGTTCTCAACTGG + Intronic
1187978472 X:24729386-24729408 TTAGCTCAGTGGTTCTCAACTGG - Intronic
1188018426 X:25130195-25130217 ATAAATCAGTGGTTCTCAAAAGG - Intergenic
1188024358 X:25193335-25193357 CTAGAGCAGCGGTTCTCAACTGG - Intergenic
1188195765 X:27231067-27231089 CTAAAGTAGTGGTTCTCAAACGG + Intergenic
1188251022 X:27894363-27894385 CTACAACAGTAGTTCGCAACTGG - Intergenic
1188260722 X:28019960-28019982 CTAGACCAGTGGTTGTCAACTGG - Intergenic
1188535262 X:31190076-31190098 CTAGGTCGGTGGTTCTCAACCGG + Intronic
1188604845 X:32015560-32015582 CTAGAGTAGTAGTTCTCAAAGGG - Intronic
1189026172 X:37396987-37397009 TCAGAGTAGTGGTTCTCAACTGG - Intronic
1189162557 X:38825311-38825333 CTACACCAGTAGTTCTCGACTGG - Intergenic
1189528872 X:41857365-41857387 ATAGAGCAATGATTCTCAACTGG - Intronic
1189715200 X:43857968-43857990 TTAGATCAGAGGTTCTAAATTGG - Intronic
1189719031 X:43896004-43896026 CTAGAGCAGTGGTTCTCAATAGG - Intergenic
1190005607 X:46734208-46734230 CTACAACAATGGTTCTCAACTGG - Intronic
1190433612 X:50402070-50402092 CTAAACCAGTGGTCCTCAACTGG - Intronic
1191100907 X:56727556-56727578 ATAGACCAATGGTTCTCAACTGG + Intergenic
1191665190 X:63695233-63695255 ATAGAATAGTGGTTCTCAACCGG - Intronic
1192258758 X:69490147-69490169 ATAAGTCAGTGGTTCTCAACTGG + Intergenic
1192264217 X:69527903-69527925 GTGGATCAGTGGTTGACAACTGG + Intronic
1192598136 X:72433136-72433158 ATAAACCAGTTGTTCTCAACAGG + Intronic
1193411275 X:81166172-81166194 CTAGATCAGTCGCTATTAACTGG - Intronic
1194041909 X:88951795-88951817 CTAGAGCAGCGTTTCTCAACTGG + Intergenic
1195011618 X:100737747-100737769 CTTGACCAGTGGTTCTCAACTGG - Intergenic
1195056350 X:101149453-101149475 CTAGAGCAGTGATTCTACACTGG + Intronic
1195110062 X:101639540-101639562 CTAGACCAGGTGTTCTCAACTGG - Intergenic
1195281560 X:103339668-103339690 CTAGATCAGGCGTTCTCAACTGG - Intergenic
1195363378 X:104106159-104106181 CTAGTACAGTGGTTCTAAGCCGG - Intronic
1195481243 X:105347912-105347934 CTAGAGTAGTGGTCCTCGACTGG - Intronic
1195574302 X:106432555-106432577 CTAGAGCAATGGTTCTCAACTGG - Intergenic
1195641666 X:107182374-107182396 CTAGTTCAGTAGTTCTCAGCTGG - Intronic
1195717469 X:107830692-107830714 CTAGAAAAGTGTTTCTCAACTGG + Intronic
1195853145 X:109305026-109305048 CTAGATCAGTTATTCTTAACTGG - Intergenic
1196048458 X:111280604-111280626 TTACAACAGTGGTTCTCAACTGG - Intergenic
1196087269 X:111697510-111697532 CCAGAACAGTGGTTCTCAAGTGG - Intronic
1196165079 X:112529875-112529897 CTAGAGCAGTAGTTCTCAATGGG + Intergenic
1196191211 X:112796737-112796759 TTATATCAATGGTTCTCAACTGG + Intronic
1196411687 X:115426299-115426321 TTAGGCCAGTGGTTCTTAACAGG - Intergenic
1196709408 X:118746819-118746841 ATAGATCAGTGATTCTCAATTGG - Intronic
1197004362 X:121478824-121478846 CTAAATCAGTGTTTCTCAATAGG + Intergenic
1197189259 X:123627401-123627423 CAAGAGCAGTAGTTCTCAAGAGG - Intronic
1197199601 X:123736471-123736493 GTAGCTCAGTGGTTCTCAAAAGG - Intergenic
1197358150 X:125462575-125462597 CTAAGTCAGTGATTCTCAACTGG - Intergenic
1198159015 X:133988527-133988549 CTAGGTCAGTGCTTCCCAAAGGG + Intergenic
1198318160 X:135490431-135490453 CTGGTTCAGTGATTCTCAACTGG + Intergenic
1198416905 X:136429585-136429607 ATGGAGCAGTGGTTCTCAGCAGG - Intergenic
1198417096 X:136431311-136431333 ATGGAGCAGTGGTTCTCAGCAGG + Intergenic
1198445997 X:136715041-136715063 CTAAGCCAGTGATTCTCAACTGG - Intronic
1198574259 X:137992757-137992779 TTACAACAGTGGTCCTCAACAGG - Intergenic
1198674415 X:139117129-139117151 TTAACCCAGTGGTTCTCAACTGG + Intronic
1198675112 X:139123072-139123094 TTAGGGCAGTGGTTCTCAACGGG - Intronic
1198929640 X:141839750-141839772 TTAACTCAGTGGTTCTTAACTGG + Intronic
1199084419 X:143612203-143612225 ACAGATCAGTAGTTGTCAACTGG - Intergenic
1199201433 X:145094669-145094691 CTAGAATAGTAGTTCTCAACTGG + Intergenic
1199472341 X:148209103-148209125 CTAAAGCAGTGGGTCTCAACTGG - Intergenic
1199778424 X:151036060-151036082 CTAATGCAGTGGTTCTCAAGGGG - Intergenic
1199923537 X:152436477-152436499 ATAATTCAGTGGTTCCCAACTGG - Intronic
1200360416 X:155599776-155599798 CTAAAGTAGTGGTTTTCAACAGG + Intronic