ID: 1069384961

View in Genome Browser
Species Human (GRCh38)
Location 10:67875832-67875854
Sequence GATCTAGGTTTATATACTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069384958_1069384961 -7 Left 1069384958 10:67875816-67875838 CCAGTTGAGAACCACTGATCTAG 0: 4
1: 46
2: 199
3: 497
4: 987
Right 1069384961 10:67875832-67875854 GATCTAGGTTTATATACTGCTGG No data
1069384956_1069384961 20 Left 1069384956 10:67875789-67875811 CCTCTAGGGGATGGAGGGCAAAA No data
Right 1069384961 10:67875832-67875854 GATCTAGGTTTATATACTGCTGG No data
1069384957_1069384961 -6 Left 1069384957 10:67875815-67875837 CCCAGTTGAGAACCACTGATCTA 0: 10
1: 76
2: 324
3: 848
4: 1507
Right 1069384961 10:67875832-67875854 GATCTAGGTTTATATACTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069384961 Original CRISPR GATCTAGGTTTATATACTGC TGG Intergenic
No off target data available for this crispr