ID: 1069393565

View in Genome Browser
Species Human (GRCh38)
Location 10:67963726-67963748
Sequence AAACCCTCACACACCAACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069393565_1069393568 4 Left 1069393565 10:67963726-67963748 CCCTGGTTGGTGTGTGAGGGTTT No data
Right 1069393568 10:67963753-67963775 GCAAAGTCTTGGTATGAACAAGG No data
1069393565_1069393567 -7 Left 1069393565 10:67963726-67963748 CCCTGGTTGGTGTGTGAGGGTTT No data
Right 1069393567 10:67963742-67963764 AGGGTTTATATGCAAAGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069393565 Original CRISPR AAACCCTCACACACCAACCA GGG (reversed) Intronic
No off target data available for this crispr