ID: 1069408871

View in Genome Browser
Species Human (GRCh38)
Location 10:68131672-68131694
Sequence AGAATACCGCCTATGAAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 64}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069408871_1069408873 16 Left 1069408871 10:68131672-68131694 CCAGCCTTCATAGGCGGTATTCT 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1069408873 10:68131711-68131733 AAGATTTGTAATCTTTTCTCTGG No data
1069408871_1069408874 17 Left 1069408871 10:68131672-68131694 CCAGCCTTCATAGGCGGTATTCT 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1069408874 10:68131712-68131734 AGATTTGTAATCTTTTCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069408871 Original CRISPR AGAATACCGCCTATGAAGGC TGG (reversed) Intronic
901419067 1:9137967-9137989 AGAATTCTGCCCATCAAGGCCGG - Intergenic
904655161 1:32040115-32040137 AGAATAGTGCCTATTAGGGCCGG + Intronic
909137299 1:71817456-71817478 GGAATAGCGCCTATGAAAGGAGG - Intronic
913672439 1:121110376-121110398 AGAATAAGTCCTATGAAGGTAGG - Intergenic
914024203 1:143897740-143897762 AGAATAAGTCCTATGAAGGTAGG - Intergenic
914662696 1:149805767-149805789 AGAATAAGTCCTATGAAGGTAGG - Intronic
914703306 1:150152000-150152022 AGAATACCTCCCGTGAGGGCGGG - Intronic
920803620 1:209211808-209211830 AGTATGGCACCTATGAAGGCTGG - Intergenic
1065376544 10:25048999-25049021 AGAATAGCGATTAAGAAGGCTGG + Intronic
1068424958 10:56847854-56847876 AGAATATTGCCTTTGAAGGAAGG - Intergenic
1069408871 10:68131672-68131694 AGAATACCGCCTATGAAGGCTGG - Intronic
1070680264 10:78444054-78444076 AGGAGACCGCCTGCGAAGGCAGG + Intergenic
1074933759 10:118157473-118157495 AGAAAAAAACCTATGAAGGCAGG - Intergenic
1084711136 11:70844397-70844419 AGAATGCTGGCTGTGAAGGCTGG - Intronic
1101201201 12:102438217-102438239 AGAAGACCGCAGAGGAAGGCAGG - Intronic
1103995610 12:124828148-124828170 AGAGTACCGCCTGTTTAGGCCGG + Intronic
1105829960 13:24155430-24155452 AGAATACTGCTTGTGAAGGATGG + Intronic
1107427413 13:40307682-40307704 ATAATACCACCTTTGAAAGCTGG - Intergenic
1110313565 13:74079022-74079044 AGAATACCGTATATCAAGTCTGG - Intronic
1118902272 14:69996455-69996477 AGAATACAGCCCAAGAAGACAGG - Intronic
1121282624 14:92710289-92710311 AGGATGCCGCCTATCCAGGCGGG + Intronic
1143241215 17:5444727-5444749 AAACTACCGCCTGTGAAGGTAGG + Intronic
1152985211 18:314721-314743 ACAATCCCGGCTATGAAGGCAGG + Intergenic
1158261262 18:55608670-55608692 ATAATACCTTCTTTGAAGGCGGG - Intronic
1168299138 19:55393336-55393358 AGATTACAGCCTAAGGAGGCTGG - Intronic
936041732 2:109154985-109155007 AAAATGACTCCTATGAAGGCTGG - Intronic
938810960 2:134852428-134852450 AGAATATTGCCTACGATGGCTGG - Intronic
939949958 2:148458296-148458318 AGAATGTGGCCTATAAAGGCGGG + Exonic
1169745046 20:8935080-8935102 AGAAAACGGCCCAGGAAGGCTGG - Intronic
955600036 3:60635430-60635452 AGAAAACGGCTTATGAAGGAGGG - Intronic
957322615 3:78651833-78651855 CCAATACCTGCTATGAAGGCCGG + Exonic
962020519 3:131496208-131496230 AGAATTACTCATATGAAGGCTGG + Intronic
964638780 3:158886070-158886092 AGAATGCAGCATATGAAGTCAGG + Intergenic
965821671 3:172690232-172690254 AGAATACAGAGTATGAACGCAGG + Intronic
968865619 4:3209456-3209478 CGAATAGAGCCTAAGAAGGCAGG - Intronic
975914287 4:79305072-79305094 AGAATTCAGCCCATGAAGACAGG - Intronic
977453267 4:97225556-97225578 ATAAAACGGCCTAAGAAGGCAGG - Intronic
977597683 4:98901532-98901554 AGAAGAATGCCTATGAAGGATGG - Intronic
978142021 4:105328918-105328940 CGAATACAGCCTCTGTAGGCAGG + Intergenic
978183640 4:105832957-105832979 TGAAAACAGCCTAGGAAGGCTGG - Intronic
979010957 4:115367030-115367052 AGAATACTGGCTTTGAAGGATGG - Intergenic
980847804 4:138344847-138344869 AGAATCTCTCCTATGAAGGATGG + Intergenic
981396398 4:144254750-144254772 AGAAAACAGCCAATGATGGCAGG - Intergenic
986413403 5:7504456-7504478 AACACAACGCCTATGAAGGCAGG + Intronic
986663599 5:10080790-10080812 AGCAAGCCGCCTCTGAAGGCTGG + Intergenic
986772324 5:10985541-10985563 AAAATGCAGCCTATGAGGGCTGG - Intronic
987188289 5:15447014-15447036 AGAAATCTGCCTATGAAAGCAGG + Intergenic
990072487 5:51801507-51801529 AGAATACCTCCTACTAAGGCTGG - Intergenic
991966334 5:72095105-72095127 AGAGTAAGGCCTATGAAGGGAGG + Intergenic
999533535 5:152489464-152489486 AGAACTCTGCCTATGAAGGTAGG + Intergenic
1003737294 6:8890979-8891001 AAAATACTGTCTATGAAGGTGGG + Intergenic
1007668037 6:43527954-43527976 ACAGTAGCCCCTATGAAGGCTGG + Intronic
1008860814 6:56147973-56147995 AGAAGACAGCCTATGAGGGAGGG - Intronic
1013704042 6:112811429-112811451 AGAATACCTTCTGTGAAGACAGG + Intergenic
1018351491 6:162964510-162964532 AGGATATGGCCTATGAAGGCTGG + Intronic
1023855071 7:44177936-44177958 AGAAATCAGCCTATGAGGGCGGG + Intronic
1027972429 7:85102527-85102549 TGATTACAGCCTATGATGGCAGG + Intronic
1028530704 7:91835443-91835465 AGAACACCTCCTCTGAAGTCTGG + Intronic
1031964156 7:128015376-128015398 AGATTAGCGCTGATGAAGGCTGG - Intronic
1053544582 9:39009644-39009666 AGAATAGCCCCTATGAACTCAGG + Intergenic
1053809017 9:41833126-41833148 AGAATATCCCCTATGAACTCAGG + Intergenic
1054621575 9:67354302-67354324 AGAATATCCCCTATGAACTCAGG - Intergenic
1054769474 9:69070246-69070268 AGAAAACGGCCCAGGAAGGCTGG + Intronic
1055336137 9:75235390-75235412 AGAAGGCCGGCTGTGAAGGCTGG - Intergenic
1057731571 9:97613514-97613536 AGAACACTGCCTCTTAAGGCTGG - Intronic
1189532285 X:41898188-41898210 AAAATACAGCCTATCAAGACTGG - Intronic
1197154317 X:123253461-123253483 AGAATAGCGCCCTTCAAGGCTGG - Exonic
1198987653 X:142474411-142474433 AGAATACAGGCTTTGGAGGCAGG + Intergenic