ID: 1069408871

View in Genome Browser
Species Human (GRCh38)
Location 10:68131672-68131694
Sequence AGAATACCGCCTATGAAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069408871_1069408873 16 Left 1069408871 10:68131672-68131694 CCAGCCTTCATAGGCGGTATTCT No data
Right 1069408873 10:68131711-68131733 AAGATTTGTAATCTTTTCTCTGG No data
1069408871_1069408874 17 Left 1069408871 10:68131672-68131694 CCAGCCTTCATAGGCGGTATTCT No data
Right 1069408874 10:68131712-68131734 AGATTTGTAATCTTTTCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069408871 Original CRISPR AGAATACCGCCTATGAAGGC TGG (reversed) Intronic