ID: 1069408873

View in Genome Browser
Species Human (GRCh38)
Location 10:68131711-68131733
Sequence AAGATTTGTAATCTTTTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069408869_1069408873 24 Left 1069408869 10:68131664-68131686 CCACTATGCCAGCCTTCATAGGC 0: 1
1: 0
2: 1
3: 14
4: 152
Right 1069408873 10:68131711-68131733 AAGATTTGTAATCTTTTCTCTGG No data
1069408872_1069408873 12 Left 1069408872 10:68131676-68131698 CCTTCATAGGCGGTATTCTTTAA 0: 1
1: 0
2: 0
3: 1
4: 82
Right 1069408873 10:68131711-68131733 AAGATTTGTAATCTTTTCTCTGG No data
1069408871_1069408873 16 Left 1069408871 10:68131672-68131694 CCAGCCTTCATAGGCGGTATTCT 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1069408873 10:68131711-68131733 AAGATTTGTAATCTTTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069408873 Original CRISPR AAGATTTGTAATCTTTTCTC TGG Intronic
No off target data available for this crispr