ID: 1069409323

View in Genome Browser
Species Human (GRCh38)
Location 10:68136390-68136412
Sequence CTAAAAACATGCCACCGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069409320_1069409323 9 Left 1069409320 10:68136358-68136380 CCATTCTGTAAGTGTCATGAGGA 0: 1
1: 0
2: 1
3: 8
4: 169
Right 1069409323 10:68136390-68136412 CTAAAAACATGCCACCGGTCAGG No data
1069409317_1069409323 23 Left 1069409317 10:68136344-68136366 CCTGGCACCTACTGCCATTCTGT 0: 1
1: 0
2: 0
3: 19
4: 227
Right 1069409323 10:68136390-68136412 CTAAAAACATGCCACCGGTCAGG No data
1069409318_1069409323 16 Left 1069409318 10:68136351-68136373 CCTACTGCCATTCTGTAAGTGTC 0: 1
1: 0
2: 1
3: 17
4: 200
Right 1069409323 10:68136390-68136412 CTAAAAACATGCCACCGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069409323 Original CRISPR CTAAAAACATGCCACCGGTC AGG Intronic
No off target data available for this crispr