ID: 1069417405

View in Genome Browser
Species Human (GRCh38)
Location 10:68213135-68213157
Sequence GCCCAAAATGTCTTCAGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069417400_1069417405 7 Left 1069417400 10:68213105-68213127 CCACTAGTTGTTCTTCCCCAAGT No data
Right 1069417405 10:68213135-68213157 GCCCAAAATGTCTTCAGACATGG No data
1069417403_1069417405 -9 Left 1069417403 10:68213121-68213143 CCCAAGTTGTGGCAGCCCAAAAT No data
Right 1069417405 10:68213135-68213157 GCCCAAAATGTCTTCAGACATGG No data
1069417399_1069417405 14 Left 1069417399 10:68213098-68213120 CCTCTATCCACTAGTTGTTCTTC No data
Right 1069417405 10:68213135-68213157 GCCCAAAATGTCTTCAGACATGG No data
1069417404_1069417405 -10 Left 1069417404 10:68213122-68213144 CCAAGTTGTGGCAGCCCAAAATG No data
Right 1069417405 10:68213135-68213157 GCCCAAAATGTCTTCAGACATGG No data
1069417397_1069417405 20 Left 1069417397 10:68213092-68213114 CCCTGGCCTCTATCCACTAGTTG No data
Right 1069417405 10:68213135-68213157 GCCCAAAATGTCTTCAGACATGG No data
1069417402_1069417405 -8 Left 1069417402 10:68213120-68213142 CCCCAAGTTGTGGCAGCCCAAAA No data
Right 1069417405 10:68213135-68213157 GCCCAAAATGTCTTCAGACATGG No data
1069417398_1069417405 19 Left 1069417398 10:68213093-68213115 CCTGGCCTCTATCCACTAGTTGT No data
Right 1069417405 10:68213135-68213157 GCCCAAAATGTCTTCAGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069417405 Original CRISPR GCCCAAAATGTCTTCAGACA TGG Intergenic
No off target data available for this crispr