ID: 1069419153

View in Genome Browser
Species Human (GRCh38)
Location 10:68231196-68231218
Sequence GGCGCGCGCCTCCGCGGGGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 271}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069419153_1069419169 26 Left 1069419153 10:68231196-68231218 CCACCCCCGCGGAGGCGCGCGCC 0: 1
1: 0
2: 2
3: 19
4: 271
Right 1069419169 10:68231245-68231267 GCTGGAAGCCGAAGAGTCTCTGG 0: 1
1: 1
2: 0
3: 10
4: 131
1069419153_1069419165 3 Left 1069419153 10:68231196-68231218 CCACCCCCGCGGAGGCGCGCGCC 0: 1
1: 0
2: 2
3: 19
4: 271
Right 1069419165 10:68231222-68231244 GGTGGCCATCTGGAAGGGCTCGG 0: 1
1: 0
2: 2
3: 31
4: 231
1069419153_1069419161 -3 Left 1069419153 10:68231196-68231218 CCACCCCCGCGGAGGCGCGCGCC 0: 1
1: 0
2: 2
3: 19
4: 271
Right 1069419161 10:68231216-68231238 GCCCTAGGTGGCCATCTGGAAGG 0: 1
1: 0
2: 1
3: 14
4: 120
1069419153_1069419163 -2 Left 1069419153 10:68231196-68231218 CCACCCCCGCGGAGGCGCGCGCC 0: 1
1: 0
2: 2
3: 19
4: 271
Right 1069419163 10:68231217-68231239 CCCTAGGTGGCCATCTGGAAGGG 0: 1
1: 0
2: 0
3: 12
4: 122
1069419153_1069419160 -7 Left 1069419153 10:68231196-68231218 CCACCCCCGCGGAGGCGCGCGCC 0: 1
1: 0
2: 2
3: 19
4: 271
Right 1069419160 10:68231212-68231234 GCGCGCCCTAGGTGGCCATCTGG 0: 1
1: 0
2: 0
3: 1
4: 37
1069419153_1069419166 4 Left 1069419153 10:68231196-68231218 CCACCCCCGCGGAGGCGCGCGCC 0: 1
1: 0
2: 2
3: 19
4: 271
Right 1069419166 10:68231223-68231245 GTGGCCATCTGGAAGGGCTCGGG 0: 1
1: 0
2: 2
3: 16
4: 196
1069419153_1069419168 8 Left 1069419153 10:68231196-68231218 CCACCCCCGCGGAGGCGCGCGCC 0: 1
1: 0
2: 2
3: 19
4: 271
Right 1069419168 10:68231227-68231249 CCATCTGGAAGGGCTCGGGCTGG 0: 1
1: 0
2: 2
3: 7
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069419153 Original CRISPR GGCGCGCGCCTCCGCGGGGG TGG (reversed) Exonic
901050821 1:6425134-6425156 GGCGCGGGCCGCGGCGGGGAGGG - Exonic
901660687 1:10796257-10796279 GGCGCGCGGCTCCGGGGGAGGGG - Intronic
902067555 1:13700479-13700501 GGCGCGGGCCTCCGGGTCGGTGG + Intronic
902169600 1:14599156-14599178 GGCCAGCGCCTCGGCGGCGGGGG + Exonic
902214171 1:14924223-14924245 GGCGCGCGCCGCCGGCCGGGCGG + Intronic
902501447 1:16914151-16914173 GGCGCGCGCGTGCGCGGGGGCGG + Intronic
902520211 1:17011615-17011637 GGCTCGCGACCCCGCGGTGGGGG + Intronic
902680734 1:18042185-18042207 GGCAGGGGCCCCCGCGGGGGTGG + Intergenic
904485939 1:30824608-30824630 GGCCGGCGCCCCCGCCGGGGCGG + Intergenic
904973942 1:34441719-34441741 GGCCGGCGGCTCCGCAGGGGAGG + Intergenic
905066844 1:35192089-35192111 TGCGCGCGCCGCTGCGGGGGCGG - Intronic
905179152 1:36156008-36156030 GGCGCGGGGCTCCGGGGCGGGGG + Intronic
905630456 1:39515379-39515401 GCCGAGCGCATCCGCGCGGGGGG + Intronic
905667305 1:39770810-39770832 GCCGAGCGCATCCGCGCGGGGGG - Exonic
906377037 1:45304103-45304125 GGCGCGCGGGGCCGCGGGGCAGG - Intronic
910251239 1:85201068-85201090 GGCGGGCTCCTCCCTGGGGGCGG - Intergenic
910787997 1:91021660-91021682 GGCGGCCGCCGCCGCGGGGCGGG - Intronic
910981244 1:92961547-92961569 GGCGCGCGCCGCGGCGGGGGCGG - Intergenic
912492711 1:110070728-110070750 GGCGCGCGCCGCGGGGGGCGGGG + Intronic
915247664 1:154567985-154568007 GGAGCGCGCCGCCGGGGGGAGGG - Exonic
915458415 1:156055003-156055025 GGCGCGCGGCTCCCTGAGGGAGG + Intronic
918480671 1:184974117-184974139 GGCGCGCTCCGGCGCGGGTGTGG - Intronic
921172100 1:212558982-212559004 TGCGCGCGGCCCGGCGGGGGCGG + Intergenic
921355448 1:214281069-214281091 CTCGCGCGCCCCCGCGGGGAGGG - Intergenic
921692245 1:218164851-218164873 GGCTCGCTCCTCCGCGGCCGGGG + Intergenic
922250665 1:223846061-223846083 TGCGCGCGCCTGCGCGGGCCCGG + Intergenic
922705637 1:227788719-227788741 GGCCCGGGACTCCGCGGCGGGGG - Intergenic
924415376 1:243850954-243850976 GGCGCGCGCGTCCGCGGCCAGGG - Intronic
924527072 1:244863054-244863076 GGAGCGCGGGCCCGCGGGGGAGG - Intronic
1062874159 10:931731-931753 GGCGCGGGTCCGCGCGGGGGCGG - Intergenic
1063423988 10:5937192-5937214 GGCGCGCACCTGCTCCGGGGAGG - Exonic
1066080802 10:31928842-31928864 GGAGCGCGCCGGCGCGGGGGCGG + Intronic
1068620482 10:59176586-59176608 GGCGCGCGCTCCCGGCGGGGAGG - Exonic
1069419153 10:68231196-68231218 GGCGCGCGCCTCCGCGGGGGTGG - Exonic
1069430691 10:68331924-68331946 GCAGCGCGCCTGCGCGGTGGTGG - Intronic
1069486614 10:68827782-68827804 GGCGCGCGCCGCCTCGCGGCTGG + Exonic
1069486701 10:68828118-68828140 GGCGCGCGCCGCCTCGCGGCTGG + Intronic
1069581882 10:69572239-69572261 GGCCCAGGCCTCCACGGGGGCGG - Exonic
1070152201 10:73811776-73811798 GGGGTGCGCTTCCGCGGGCGGGG - Intronic
1070752691 10:78973538-78973560 GTCGGGCCCCTCCGCGGGGCGGG - Intergenic
1071529280 10:86376916-86376938 GGCGCGCGCGGCCTCTGGGGAGG - Intergenic
1071794672 10:88991362-88991384 TGCGCGCCGCCCCGCGGGGGCGG + Exonic
1072591586 10:96832614-96832636 TCCGCGCGCCTCCCCGGGGCTGG + Intronic
1073875268 10:107914934-107914956 GGCGCGGGGCTCTGCGCGGGCGG + Intergenic
1076710605 10:132331892-132331914 GTGGTGCGCCTGCGCGGGGGTGG - Intergenic
1076875596 10:133214160-133214182 GGGGCCCACCTACGCGGGGGTGG + Intronic
1077103643 11:832862-832884 AGCGCCCGCCGCCGCGGGAGGGG + Exonic
1077134909 11:993681-993703 GCAGCACGCCCCCGCGGGGGGGG - Intronic
1077214543 11:1389990-1390012 GGCGCGGGCCTCGGCGGCGGCGG + Intronic
1080628522 11:34052171-34052193 AGCCGGCGGCTCCGCGGGGGAGG + Intronic
1081699973 11:45146804-45146826 GGCGGGCGGCTCGGCGGAGGCGG - Intronic
1083599646 11:63938942-63938964 GGCGCGCGGTTGGGCGGGGGGGG + Intronic
1083672182 11:64305750-64305772 GGGGAGCGCTGCCGCGGGGGTGG + Intronic
1083772982 11:64878672-64878694 GGCTAGCGCCGCCGCGGCGGGGG + Exonic
1084187566 11:67482955-67482977 CGCGCGCGTCTGCTCGGGGGCGG - Intergenic
1085037471 11:73308838-73308860 CGGGCGCGGCTGCGCGGGGGCGG - Exonic
1085641587 11:78196378-78196400 GGCGCGCGCCTCTACGTGGGCGG + Exonic
1087141269 11:94768254-94768276 GCCGGGCGCCACGGCGGGGGTGG + Intronic
1090699331 11:129279691-129279713 CGCGCGCGCGGCCGAGGGGGCGG + Intergenic
1091226046 11:133956928-133956950 GGCGCGCGCCTCCCCGGCCCCGG + Exonic
1094041011 12:26122231-26122253 GGCGCCCGCCTTCTCGGGAGGGG + Exonic
1096284146 12:50283549-50283571 CGTGCGCGCCCCCGCGGCGGTGG - Intergenic
1096459385 12:51814042-51814064 GGCGCGCGCCCCCGGGGGCCTGG - Intergenic
1096647593 12:53047190-53047212 GGCGCGGGGCGCGGCGGGGGCGG + Intronic
1099989761 12:89709306-89709328 GGCGCGAGCTTCGGCGGCGGTGG - Intergenic
1100618407 12:96249374-96249396 GACGCGCGCCACTGCGGAGGGGG + Intronic
1103704626 12:122864712-122864734 GGCGCACGGCTCAGCTGGGGCGG + Intergenic
1103704633 12:122864753-122864775 GGCGCACGGCTCAGCCGGGGCGG + Intergenic
1104376169 12:128267073-128267095 GTCGCGGGGCTCGGCGGGGGCGG + Intergenic
1104961466 12:132490285-132490307 GGGGCGCGCCCCCGGGGGGGCGG + Exonic
1105270896 13:18874954-18874976 GGCGCGCGCCTGCACCGCGGTGG + Intergenic
1105830666 13:24160947-24160969 GGCGCGCGGCTCTGCCGGGCGGG + Intronic
1106735816 13:32586845-32586867 GGCGCGCGCCTCCACGCCGCGGG + Intronic
1106956315 13:34942633-34942655 GGCGCTCTCCCCCGCGGAGGCGG - Exonic
1107467845 13:40665936-40665958 GGCGCCCGGCTCCGTGGCGGCGG - Exonic
1107468027 13:40666652-40666674 CGCGCGCGCCGCCGCGGGCGGGG - Intergenic
1107534114 13:41311458-41311480 GGCGCTCCGCTTCGCGGGGGTGG - Exonic
1108577779 13:51804168-51804190 GGCGGGCGACTCCCGGGGGGCGG - Intergenic
1110450725 13:75635904-75635926 GCCGCGCTCCCCAGCGGGGGAGG + Intronic
1112438540 13:99408622-99408644 GGCCCGCGCCTCCGCACGGCTGG - Intergenic
1113799444 13:113078689-113078711 GGGCCGCGGCTCAGCGGGGGAGG + Exonic
1113820370 13:113209024-113209046 GGCGCGCGCGCCCGAGGAGGGGG + Intronic
1114483207 14:23047946-23047968 GGCCCGGCCCACCGCGGGGGGGG - Exonic
1117038076 14:51747066-51747088 GGCGGGCGCCTCCGCGATGCGGG + Intergenic
1117253234 14:53955102-53955124 GTCCCGCGCCACCGCTGGGGCGG + Intronic
1117875926 14:60249716-60249738 GGTGCGGGCCTGCGCGGCGGCGG + Intronic
1118220968 14:63853767-63853789 GCCTAGCGCCTCCGCGGGGGCGG + Intronic
1120521854 14:85533783-85533805 GGCGCGCGCCTCCCCGCAGCGGG - Intronic
1122077745 14:99246610-99246632 GGCGCAGAGCTCCGCGGGGGCGG - Intronic
1122220979 14:100239073-100239095 GGCGGGCGCCGCGGCGGCGGCGG - Exonic
1122602494 14:102928606-102928628 GGAGGGCGCCTCCGGGGGCGTGG + Intronic
1122775919 14:104116942-104116964 TCCGCGCGCCCGCGCGGGGGTGG - Intergenic
1128089813 15:64911866-64911888 GAGGCGCGCGTCCGCCGGGGCGG - Intronic
1129260771 15:74365994-74366016 GGCGCTCGGCCCCGCGGAGGCGG - Intronic
1129675996 15:77632679-77632701 GGCGCGCTCCGCCGCGGGGCCGG + Intronic
1130224400 15:82046250-82046272 GGCGCGCGCCAGGCCGGGGGCGG + Intergenic
1130283997 15:82540582-82540604 GGCGCGCCCCTCCGGTGGGCAGG + Intronic
1130335357 15:82952925-82952947 GGGGCGCGCCAACGCGGGGCCGG - Intronic
1132453624 16:10557-10579 GGCGCGCGCCTTTGCGACGGCGG - Intergenic
1132608048 16:801663-801685 GGCCCACGCTTCCCCGGGGGTGG - Intergenic
1132645591 16:997908-997930 GGGGCGCGGCTCCCCTGGGGAGG + Intergenic
1132724674 16:1333610-1333632 GGCGGACGCCGCTGCGGGGGCGG - Intronic
1132968642 16:2673668-2673690 GGGGCGGGGCTCTGCGGGGGTGG + Intergenic
1133218523 16:4307840-4307862 GGCCCAAGCCTCCGCCGGGGCGG - Intergenic
1133271891 16:4614440-4614462 GACTCGCGGCCCCGCGGGGGCGG + Intronic
1134134169 16:11668628-11668650 GGCGCGCGCGGCGGCGGGGCCGG + Intronic
1136512708 16:30748789-30748811 GGCGGGGGCCTGCGCGGAGGAGG - Exonic
1138229917 16:55329254-55329276 GGCTCGCTCCTCCGCGGGCACGG - Exonic
1138327920 16:56191184-56191206 GGCCCGCGGCTCCCCCGGGGTGG - Intergenic
1138426050 16:56932544-56932566 GGCGCCCGCGTCGGCGGGGCAGG - Intronic
1139471005 16:67178177-67178199 GGTGTGCGCCAGCGCGGGGGAGG - Exonic
1139475345 16:67200061-67200083 GGCGGGGGCCTCCGGGGCGGGGG - Intronic
1139633656 16:68245357-68245379 GGCTCTCGCCTAGGCGGGGGCGG - Exonic
1139806177 16:69566570-69566592 GGCCGGCGGCTCCGCGGGGGAGG - Intronic
1140033849 16:71358606-71358628 GGGGCGCGGCGCGGCGGGGGCGG - Intergenic
1141972314 16:87492388-87492410 GGCGGGCGCCGGGGCGGGGGCGG + Intergenic
1142148619 16:88503041-88503063 GGGGCGCTGCTCCGCGGGGCAGG + Intronic
1142211796 16:88811928-88811950 CGAGCGCGCCTGCGCGGGGACGG + Exonic
1143148265 17:4790184-4790206 GGCCCGCGCCTCCGCCTCGGTGG - Exonic
1145197644 17:20908665-20908687 GCAGCGCGCCTGCGCGTGGGGGG - Intergenic
1147028368 17:37609231-37609253 CCCGCTGGCCTCCGCGGGGGCGG - Intronic
1147139588 17:38453786-38453808 GGCCCGCGGCTCCGGGGGGCGGG + Intronic
1147286001 17:39402531-39402553 GGGGCGCGCGTCCGTGGGGGTGG + Intergenic
1147720447 17:42536500-42536522 GGTGCGCGGCTCCACGGGCGTGG + Exonic
1148240750 17:45998119-45998141 GGAGAGCGCCTGCGTGGGGGAGG - Intronic
1148818232 17:50346006-50346028 GGCGCGCGCCGGGGCGGGGCCGG - Intergenic
1150768284 17:68020078-68020100 GGCGCGCGCCGCCGCCGCTGGGG - Intergenic
1151296905 17:73192824-73192846 GGCGGGCGCGGGCGCGGGGGCGG - Intronic
1151582316 17:74987586-74987608 GGAGCTCGGCTCCGCGGGGTGGG - Intergenic
1152356750 17:79811271-79811293 TGCGCGCGCCTCGGCGGGTTGGG - Intergenic
1152396543 17:80036540-80036562 GGCGCGCGCCTCTGCGTGCGTGG + Intergenic
1152938307 17:83153059-83153081 GCCGCGCGCATCCTCGGGGGGGG + Intergenic
1153514307 18:5890701-5890723 GGCGCGCGCCGCCAGGGGGCAGG - Exonic
1154416677 18:14179092-14179114 GGCGCGCGCCTGCACCGCGGTGG - Intergenic
1156452536 18:37274841-37274863 GGCCTGCGCCTCGGCGTGGGAGG + Exonic
1157464256 18:47930672-47930694 GGCGCGCGCCTGAGGGGAGGAGG - Intronic
1160570052 18:79810010-79810032 GGCGGGCGGCTCCGCGAGGCTGG - Intergenic
1160706231 19:531554-531576 GCCGAGCGCCTCCGCCGGGAGGG - Intergenic
1160864571 19:1251097-1251119 GGCGGCCGCCTGCGCCGGGGAGG + Intronic
1160968916 19:1758777-1758799 GGCGGGCTCCTCGGCGGGGGTGG + Intronic
1161076994 19:2290616-2290638 GCCGCGCACCTCGGCCGGGGTGG + Exonic
1161210407 19:3062551-3062573 CGTGCGCGCCGCCGAGGGGGGGG + Intronic
1161596014 19:5151358-5151380 GGAGCCCGCCTTCTCGGGGGAGG + Exonic
1161707239 19:5827854-5827876 GGCGCGCGCGTGCGCGGTTGGGG + Exonic
1161990250 19:7680726-7680748 GGCGCGCGAGTCCGCGGAGCCGG - Intronic
1162033162 19:7925940-7925962 GGGGCGCGCCGGGGCGGGGGCGG - Intronic
1162893096 19:13748030-13748052 GGCGCGCCCTTCCGCGTCGGGGG + Intronic
1163320567 19:16572324-16572346 GGCGCGGGCCACGGCGCGGGGGG - Exonic
1163464012 19:17455684-17455706 GGCGGGCGCGACCCCGGGGGAGG - Exonic
1163762574 19:19145673-19145695 GACGCCCCCCTCCGCGGTGGGGG - Exonic
1164624104 19:29715215-29715237 TGCGCGACCCTCCGCGGGGCTGG - Intronic
1164977085 19:32581389-32581411 AGGGCGCGCCTCCGGGGCGGAGG + Intronic
1166306905 19:41940413-41940435 GGGGCGCGCGGCGGCGGGGGAGG - Intergenic
1166366225 19:42279969-42279991 GGCGCGCGCATGCGCGGCAGAGG + Intronic
1166790390 19:45395691-45395713 GGCGCGGGGCCCCGCGGGGCTGG + Exonic
1166807708 19:45496998-45497020 GGTGCTCGGCTCGGCGGGGGCGG + Exonic
1167129154 19:47573083-47573105 GGCGCGCGAGCCCCCGGGGGCGG - Intergenic
1168408020 19:56120861-56120883 GGCGCGCGCGTGCGCGTGGCGGG - Intronic
1168452619 19:56477808-56477830 GGTGTCCGCCTCCGCGGGTGAGG - Intronic
927496757 2:23556291-23556313 CGCCTGCGCCTCCGCGAGGGGGG - Intronic
927652311 2:24920088-24920110 GGCCCGCGCTCCCGCCGGGGAGG - Intergenic
931602660 2:64019429-64019451 ACCGCGCGGCTCCGCCGGGGCGG + Intergenic
933741713 2:85539083-85539105 GGCGCGCGGCGCCGAGGGGCGGG + Intergenic
935112121 2:100104170-100104192 GGGGCGGGCCGCCGCGAGGGAGG + Intronic
935112220 2:100104487-100104509 GGCCCGAGCCTCGGCGGCGGCGG - Exonic
936038323 2:109129645-109129667 GGCGGCCACCGCCGCGGGGGCGG + Exonic
936122851 2:109760981-109761003 GGGGCGGGCCGCCGCGAGGGAGG - Intergenic
936141688 2:109947198-109947220 GGCGCGCGCCCCCTCTCGGGAGG + Intergenic
936178376 2:110245146-110245168 GGCGCGCGCCCCCTCTCGGGAGG + Intergenic
936203002 2:110424286-110424308 GGCGCGCGCCCCCTCTCGGGAGG - Intronic
936221837 2:110610483-110610505 GGGGCGGGCCGCCGCGAGGGAGG + Intergenic
937408115 2:121649292-121649314 GGCGCCCGCCACTGCGCGGGAGG + Intronic
939178677 2:138780454-138780476 CGCGCGCCCCTCCTCGGAGGGGG + Intergenic
942890555 2:180981218-180981240 GTGGCTCGCCTCCGCGGGCGCGG + Intronic
945241530 2:207681377-207681399 GGCGGGCGGATCCGCGGGGAGGG + Intergenic
948046876 2:234951966-234951988 GTCCCGCGCCTGGGCGGGGGCGG - Intronic
948115941 2:235494396-235494418 GGAGCGCGCCGCGGCGGGTGCGG - Exonic
948958609 2:241315151-241315173 GGCCCGCCGCCCCGCGGGGGAGG - Intronic
948983973 2:241508805-241508827 GCCGCGCGCCTGGGCGGGCGGGG + Intronic
1169244414 20:4014994-4015016 GGCGCGCGCCTTGGGGGGTGCGG - Intronic
1169327545 20:4687249-4687271 GCCTCGGGCCTCGGCGGGGGCGG + Intronic
1170026072 20:11891013-11891035 GGCGCGCGCCCCTGCCCGGGCGG - Intronic
1170026209 20:11891400-11891422 ACCGCGCGCCTCCCCGGGAGAGG - Intronic
1172039048 20:32031057-32031079 GGCGTGGGCATCCGCGAGGGCGG + Exonic
1175428744 20:58888781-58888803 GGCGCGCGCCGCTGGGAGGGCGG + Intronic
1175439547 20:58981197-58981219 GCCGCGCGCCTCGGCCCGGGCGG - Exonic
1175856146 20:62122136-62122158 GGAGCGCGCGTGCGCGTGGGCGG - Intergenic
1176128978 20:63488252-63488274 GGAGCGCGGCACCGCCGGGGAGG + Exonic
1176194452 20:63830940-63830962 GGAGGGCGCCCCCGCGGGGCGGG + Intronic
1176548642 21:8212363-8212385 CGCGCTCGCCCCCGCGTGGGCGG + Intergenic
1176556536 21:8256571-8256593 CGCGCTCGCCCCCGCGTGGGCGG + Intergenic
1176567573 21:8395398-8395420 CGCGCTCGCCCCCGCGTGGGCGG + Intergenic
1176575475 21:8439613-8439635 CGCGCTCGCCCCCGCGTGGGCGG + Intergenic
1176856659 21:13980168-13980190 GGCGCGCGCCTGCACCGCGGTGG + Intergenic
1176867928 21:14064024-14064046 GGCGCGCGCCTGCACCGCGGTGG - Intergenic
1179209563 21:39313634-39313656 GACCGACGCCTCCGCGGGGGAGG + Exonic
1179674962 21:42974862-42974884 GGAGCGGGCACCCGCGGGGGAGG + Intronic
1179833559 21:44012885-44012907 GGCGCGCGGCTCAACGGGGGCGG - Intronic
1180650007 22:17369673-17369695 CGCGCGGTCCTCGGCGGGGGCGG - Exonic
1184089245 22:42283709-42283731 GGCCCGAGGCTCCCCGGGGGCGG - Intronic
1185248675 22:49787633-49787655 GGCGGCGGCCTCCGCGGTGGCGG - Intronic
1203253525 22_KI270733v1_random:128668-128690 CGCGCTCGCCCCCGCGTGGGCGG + Intergenic
1203261580 22_KI270733v1_random:173746-173768 CGCGCTCGCCCCCGCGTGGGCGG + Intergenic
951485210 3:23202978-23203000 GGCGCGCGGCCGCGAGGGGGCGG - Intergenic
953705281 3:45226035-45226057 GGCGGGCGCCTACGCGCGCGAGG + Exonic
954717515 3:52533890-52533912 GGCGCGCCCCTCGGCCCGGGGGG + Intronic
954795905 3:53161283-53161305 GGCCCGGGCCTCCGCGCGGCGGG - Exonic
959849824 3:111072388-111072410 GACCCGCGCGGCCGCGGGGGAGG - Intronic
961260083 3:125595304-125595326 GGCGCGCGCAGCCGGGGAGGAGG + Intergenic
961734739 3:128994169-128994191 GGGGCGGGGCTCCGCGGGGCGGG + Intronic
963061766 3:141231920-141231942 GGCGCGGGCCTGGGCCGGGGCGG + Intronic
964330228 3:155594021-155594043 GGTGCGGGCCTCCTCGGGGTTGG + Exonic
968434173 4:576368-576390 GGCGCGCGGGGCCGCGGGCGGGG - Intergenic
968556418 4:1248418-1248440 GGAGCGCGCCTCCCGCGGGGAGG - Intronic
969240376 4:5893114-5893136 GGCGCGCGCCGGGGCGGGGCCGG + Intergenic
969285646 4:6200457-6200479 CGCGCGCGGCTCGGCGGGGCGGG + Exonic
969720956 4:8892884-8892906 GGCGCGCACCGACGCGGGGAGGG - Intergenic
973246742 4:48017373-48017395 GGCGCCCGGGGCCGCGGGGGTGG + Intronic
975342574 4:73258569-73258591 GGCGGGCCCCCCCGCGGCGGCGG - Exonic
984888642 4:184473243-184473265 GGCGCGGGCCGCGGCGGGGTGGG - Intronic
984999835 4:185471791-185471813 AGCGCGCGCCGCCGAGGGTGGGG - Intronic
985073694 4:186191969-186191991 GGCGCGGGCCACCGTGGGGATGG - Exonic
985497464 5:217945-217967 GGGGCGCTCGTCCGCGGAGGTGG - Intronic
985688625 5:1294978-1295000 AGCGCGCGGCATCGCGGGGGTGG + Exonic
987340447 5:16935472-16935494 GGCGCGCGCCGGGGCGCGGGCGG - Intronic
991913916 5:71587469-71587491 GGCGCGCGGCCCGGCGGGAGAGG - Exonic
992067325 5:73120232-73120254 GGAGCGGGCCTCGGCGGGCGGGG + Intergenic
993826227 5:92690271-92690293 GGCGGGCGCCGCCACGCGGGGGG + Intergenic
993905742 5:93621301-93621323 GGCCCGCGCCCGCGAGGGGGCGG - Intronic
996184953 5:120464178-120464200 GGCGCCCCTCTCCGCGGGCGGGG + Intergenic
998166670 5:139848281-139848303 CGCGCGCGCGGCCGCGGCGGCGG + Exonic
999328281 5:150656767-150656789 GGCGAGCGCATGCGCGGGGGCGG - Intronic
1001529893 5:172454418-172454440 GGGGCGCGCCGCCGCGGGCAGGG + Exonic
1001948042 5:175796819-175796841 GCCGCCCTCCTCCGCGGGAGCGG + Intronic
1002064901 5:176647199-176647221 GGCGGCGGCCTGCGCGGGGGCGG + Intergenic
1002691372 5:181053005-181053027 GGCGCGCGCGGCGGAGGGGGCGG - Intronic
1002888189 6:1313465-1313487 GGCGCGCTCCTCCTGGCGGGCGG - Exonic
1003290705 6:4776339-4776361 GGAGCGCGGCTCCGCAGGGCCGG + Intronic
1003942730 6:11044530-11044552 GGCGCGCGAGGCCGCAGGGGCGG - Intergenic
1004044580 6:12012111-12012133 GGCGCGCGCCGCGGCGGGGCGGG - Intronic
1005039307 6:21587464-21587486 GGCGCGCGCGTCTGCCAGGGAGG - Intergenic
1009437726 6:63636473-63636495 CGCCCGCGCCTCAGCGGCGGCGG - Intronic
1012137508 6:95577516-95577538 TGCGCGCGCCTTCGGGGAGGAGG + Intergenic
1013272553 6:108558092-108558114 GGCGCGACCCGCCGAGGGGGCGG - Intergenic
1014724986 6:124962678-124962700 GCCGCTCGGCTCCGCGGAGGCGG - Exonic
1017672008 6:156777809-156777831 GGCGCGCGGCGCGGCGGCGGCGG + Intergenic
1018400115 6:163413934-163413956 GGAGCGCGCCTGCGTGGGGCGGG - Intergenic
1018686407 6:166307767-166307789 CGCGGGCACCTCCTCGGGGGCGG - Exonic
1019435893 7:1021947-1021969 GGTTCGATCCTCCGCGGGGGTGG + Intronic
1019563894 7:1670406-1670428 GCCGCGCCGCTCCCCGGGGGTGG - Intergenic
1019989508 7:4682101-4682123 GGCGCGCGCCAGCGCGGGGCTGG - Intergenic
1020178065 7:5898689-5898711 GGCGAGCGCTTCCGGGGCGGTGG + Intergenic
1024471681 7:49773523-49773545 GGCCCGCGCTGCCCCGGGGGAGG - Intergenic
1028556784 7:92134122-92134144 GGCGCGCGCCGCAGCTGAGGCGG - Intronic
1029080790 7:97972343-97972365 GGCGAGCGCTTCCGGGGTGGTGG - Intergenic
1029708340 7:102286842-102286864 GGCGCGCGCCTCGCGGGCGGAGG + Intronic
1029708343 7:102286850-102286872 GGCGCGCCCCTCCGCCCGCGAGG - Intronic
1029927084 7:104329232-104329254 CGCGCTCACCTCCGCGGAGGCGG + Intronic
1032298797 7:130668393-130668415 GGCGCGCGCGGGCGCCGGGGCGG + Intronic
1033899227 7:146115957-146115979 GGCGCGCGCCTCTCCCTGGGCGG - Intergenic
1034147060 7:148883588-148883610 GGCGCGGGCCGCTGCCGGGGTGG - Intronic
1034158929 7:148978267-148978289 GACGTGCGCTTCCGCGGGAGGGG + Intergenic
1035050857 7:155998478-155998500 GGCGCGTGGAACCGCGGGGGTGG + Intergenic
1035404233 7:158587735-158587757 GGCGCGCGCCTCCCTGGGCCCGG - Intronic
1035747837 8:1974333-1974355 GGCGGGACCCTCGGCGGGGGCGG - Intronic
1039828519 8:41194872-41194894 GCCGCGCTCCTCTGCGGGGCGGG + Intergenic
1042962668 8:74320756-74320778 GGCGGGCGCGGGCGCGGGGGTGG + Intronic
1045516550 8:102864706-102864728 GGCGGGCGCCTCAGCCCGGGAGG - Exonic
1049457335 8:142700394-142700416 GGCGCGCGCCCCGGGGCGGGCGG + Exonic
1049585495 8:143430782-143430804 GGCGCGCGCCCCTCCCGGGGAGG - Intergenic
1049767274 8:144360683-144360705 GGTGGGCACCTCGGCGGGGGTGG + Exonic
1049850529 8:144827792-144827814 ACCTCGCGCCGCCGCGGGGGAGG - Intronic
1050472543 9:6008037-6008059 TGCGCGCGCCGCCGCCGGGGGGG - Intergenic
1055308208 9:74952250-74952272 GGCGCCCGGCTCCCGGGGGGCGG - Exonic
1056732537 9:89178331-89178353 GGCGCGCGCGACCCCGGCGGCGG - Exonic
1057643781 9:96854184-96854206 GGCGCGAGCGGCGGCGGGGGTGG - Exonic
1059483656 9:114611366-114611388 GGCGGGCGGCTCCTCGGGGTTGG + Exonic
1060700489 9:125746596-125746618 CGCGCGCACCGCCCCGGGGGCGG + Intergenic
1060996569 9:127877575-127877597 GGGGGGCGCCTCTGCGGGGAGGG - Intronic
1061975713 9:134067356-134067378 GCCGCGCGCCGCGGCCGGGGCGG - Intronic
1062394824 9:136348557-136348579 GGCGCTCGCCTCCACAAGGGGGG + Intronic
1062499675 9:136846995-136847017 GGCTCGCGGCTCCGCGCCGGGGG - Exonic
1062529789 9:136994789-136994811 GCCGCGCAGCTCCGCGGGGATGG + Exonic
1203449645 Un_GL000219v1:99869-99891 GGCGACGGTCTCCGCGGGGGCGG + Intergenic
1203469926 Un_GL000220v1:111815-111837 CGCGCTCGCCCCCGCGTGGGCGG + Intergenic
1203477747 Un_GL000220v1:155787-155809 CGCGCTCGCCCCCGCGTGGGCGG + Intergenic
1186611145 X:11139334-11139356 GGCGCGCGACACCGCAGGGTGGG + Exonic
1188003641 X:25003220-25003242 GGCGCTCCCTTCCGAGGGGGCGG - Intergenic
1189331252 X:40146229-40146251 GCTCCGCGCCTCCGCGGGAGCGG - Intronic
1190099765 X:47513549-47513571 GGCCCGCGCGGCCGCAGGGGCGG - Intergenic
1190324889 X:49200225-49200247 GGCGCGGGGCGCGGCGGGGGCGG + Exonic
1196684169 X:118496267-118496289 GGCGCACGCCTCCGCCGTGCCGG - Intronic
1200214205 X:154360263-154360285 GGAGCGGGCCACCGCTGGGGAGG - Exonic