ID: 1069422700

View in Genome Browser
Species Human (GRCh38)
Location 10:68261117-68261139
Sequence ATGGCTGAGCAGAACTAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 205}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069422694_1069422700 18 Left 1069422694 10:68261076-68261098 CCTAGATCCTGAACAACGACTTG 0: 1
1: 0
2: 1
3: 9
4: 144
Right 1069422700 10:68261117-68261139 ATGGCTGAGCAGAACTAGGAGGG 0: 1
1: 0
2: 1
3: 13
4: 205
1069422692_1069422700 23 Left 1069422692 10:68261071-68261093 CCCAGCCTAGATCCTGAACAACG 0: 1
1: 0
2: 0
3: 2
4: 68
Right 1069422700 10:68261117-68261139 ATGGCTGAGCAGAACTAGGAGGG 0: 1
1: 0
2: 1
3: 13
4: 205
1069422695_1069422700 11 Left 1069422695 10:68261083-68261105 CCTGAACAACGACTTGAGAAGCA 0: 1
1: 0
2: 0
3: 3
4: 75
Right 1069422700 10:68261117-68261139 ATGGCTGAGCAGAACTAGGAGGG 0: 1
1: 0
2: 1
3: 13
4: 205
1069422693_1069422700 22 Left 1069422693 10:68261072-68261094 CCAGCCTAGATCCTGAACAACGA 0: 1
1: 0
2: 0
3: 5
4: 41
Right 1069422700 10:68261117-68261139 ATGGCTGAGCAGAACTAGGAGGG 0: 1
1: 0
2: 1
3: 13
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069422700 Original CRISPR ATGGCTGAGCAGAACTAGGA GGG Intergenic
901400240 1:9010751-9010773 ATGAATGACCAGAACAAGGAAGG - Intronic
901535162 1:9877960-9877982 GTGGCTGGGCAGAAGTAGGAAGG + Exonic
903939814 1:26921897-26921919 ATGGCTCAGCAGCACGAGGGCGG + Exonic
905436124 1:37956410-37956432 AGGGATGGGCTGAACTAGGAAGG + Intergenic
906280407 1:44549598-44549620 ATGGGGAAGCAGAACTGGGAGGG - Intronic
907698987 1:56765102-56765124 ACTGCTGGGCAGAAGTAGGAAGG + Intronic
910076302 1:83283061-83283083 AAGGCTGTGGAGAAATAGGAAGG - Intergenic
911117497 1:94260990-94261012 ATGGGGGTGCAGAATTAGGAAGG - Intronic
912299946 1:108504437-108504459 ATGGCTGAGAAGACCAGGGAGGG - Intergenic
916263147 1:162862371-162862393 AGGGCTGAGAGTAACTAGGATGG - Intronic
916817807 1:168370605-168370627 AGGTCAGAGCAGAACCAGGAAGG - Intergenic
917006978 1:170426318-170426340 ATGGGTGAGCAGAAGCAGGGTGG + Intergenic
917168810 1:172145588-172145610 ATAGCTGAGGGAAACTAGGAAGG - Intronic
918855128 1:189743698-189743720 ATGTCTGAGCACAACTTGAAAGG + Intergenic
920110918 1:203586459-203586481 TTGGCTGAGCAGGACCAGAAGGG - Intergenic
920530305 1:206697115-206697137 ATGACTGAACAGGAATAGGAGGG - Intronic
922799290 1:228357449-228357471 ATGGCTGAGAAGCTCCAGGATGG + Intronic
923556752 1:235007107-235007129 ATGACTGAGCAGATGTGGGAAGG - Intergenic
1063502338 10:6566564-6566586 CTGGCAGAGCAGGACTAGGTAGG + Intronic
1068021467 10:51590646-51590668 ATGGCTGAGCAGTATTAGAGTGG - Intronic
1069422700 10:68261117-68261139 ATGGCTGAGCAGAACTAGGAGGG + Intergenic
1069913648 10:71774354-71774376 AGGGATGAGAAGAATTAGGAGGG - Intronic
1072002635 10:91211912-91211934 GTGGTTGAGCAGCACTAGAATGG + Intronic
1072497457 10:95976248-95976270 ATGGGTGAGCAGAAAGTGGAGGG - Intronic
1073024147 10:100474147-100474169 ATGTCTGAGAAGAGCTGGGAGGG + Intronic
1073126314 10:101152398-101152420 ATCGCTGTGCAGAACTGGGAAGG + Intergenic
1074854668 10:117464798-117464820 GGGGCTGAGCAGTAATAGGAAGG - Intergenic
1075083495 10:119399056-119399078 AAGGCTGAGCAGAGCTAGGGAGG - Intronic
1076166926 10:128290128-128290150 ATGGCTGATGACAACTTGGATGG - Intergenic
1076691304 10:132225048-132225070 ATGCCTGAGCAGGAGGAGGAAGG - Intronic
1083400161 11:62418061-62418083 ATGGCTGAGGAGAGCTAGCAGGG + Intronic
1083582840 11:63836264-63836286 ATCTTTGAGGAGAACTAGGAGGG + Intergenic
1089380897 11:118030695-118030717 AGGGCTGAGCAGGAAGAGGAAGG + Intergenic
1090896429 11:130980072-130980094 ATGGCTGAGCAGGAAAAGAAAGG + Intergenic
1093001109 12:13997119-13997141 ATGGCTAAGTGGAAATAGGAAGG + Intergenic
1093781615 12:23143612-23143634 ATGGATGTGGAGAAATAGGAAGG - Intergenic
1095705770 12:45235569-45235591 ACATCTGAGCAGAACTAGCAAGG + Intronic
1096561142 12:52436785-52436807 ATGGCTGAGAAAAACCAGAATGG - Intergenic
1097029267 12:56079942-56079964 TTGGCGGAGCAGATCGAGGATGG - Exonic
1098752690 12:74315718-74315740 CTGGCTGCCCAGAACTAGAAGGG + Intergenic
1099558385 12:84141355-84141377 ATTGCTGAGCAGATCTGGGTTGG - Intergenic
1100604889 12:96143529-96143551 AGGGCAGAGCAGAAAGAGGAAGG + Intergenic
1101710066 12:107256815-107256837 ATGGCTGCGGGGAACTAGGCTGG + Intergenic
1101723018 12:107366934-107366956 AGGCCTGAGCAGAACTTGTAGGG + Intronic
1102559997 12:113755041-113755063 ATGGCTGACCAGCACTAGAGAGG - Intergenic
1103553799 12:121753934-121753956 ATGGCTGTGCTGCACTTGGACGG - Intronic
1104774117 12:131382273-131382295 GTGGCTCAGCAGCACCAGGAGGG - Intergenic
1104774133 12:131382331-131382353 GTGGCTCAGCAGCACCAGGAGGG - Intergenic
1104774166 12:131382444-131382466 GTGGCTCAGCAGCACCAGGAGGG - Intergenic
1104774302 12:131382893-131382915 GTGGCTCAGCAGCACCAGGAGGG - Intergenic
1108705811 13:52984997-52985019 ATGACTGAGCCAAACTATGAAGG - Intergenic
1109793929 13:67285465-67285487 ATGGCTGAGAAGAAATAAGAAGG + Intergenic
1109919237 13:69034475-69034497 ATGGCTGAGGGGTATTAGGATGG + Intergenic
1110656648 13:78007886-78007908 AAGGGTGATCAGAAATAGGATGG - Intergenic
1113608477 13:111626871-111626893 ATGGCTGAGAATAACGGGGAGGG - Intronic
1114624369 14:24119192-24119214 ATGGACGAGAAGTACTAGGAGGG + Exonic
1116401994 14:44518716-44518738 ATGGCAAAGCAGTACTAAGAAGG - Intergenic
1116510000 14:45733327-45733349 ATGGCTGACTAGAAATAAGAAGG + Intergenic
1118687486 14:68305678-68305700 ATGTCAGGGCAGAACTAAGATGG + Intronic
1119200349 14:72747366-72747388 GTGGCAGAGAAGACCTAGGAAGG - Intronic
1119556381 14:75556434-75556456 AGGGCTGAGCAGAATGAGCAAGG - Intergenic
1120137195 14:80884503-80884525 GTGGATGAGCAGAAGTAGGGTGG + Intronic
1121050705 14:90817079-90817101 ATGGCTGAGCGGAGCCAGGCAGG + Intergenic
1121900461 14:97689086-97689108 AATGCTGAGCAGAACCACGAGGG + Intergenic
1124443492 15:29707462-29707484 GTGGATGTGCAGAGCTAGGAAGG + Intronic
1124637440 15:31374036-31374058 AGGGCTGAGTAGAAGCAGGATGG - Exonic
1125170095 15:36757119-36757141 ATGGCTGTGCAGTACTCAGAGGG + Intronic
1128311757 15:66635349-66635371 AGGGCTGAGCAGACCCAGAAGGG - Intronic
1128311982 15:66636584-66636606 AGGGCTGAGCAGACCCAGAAGGG - Intronic
1129103854 15:73291624-73291646 ATGACTGAGCAGTGCCAGGAAGG + Intronic
1130397569 15:83516602-83516624 ATGGCAAAGCAGAACAAGGGTGG + Intronic
1131047200 15:89323731-89323753 CTGGCTGGGAAGAACTAGGTGGG + Intronic
1131140274 15:89971635-89971657 CTGGCTGAGCAAAACCAGGTGGG + Intergenic
1131835410 15:96385701-96385723 CCGGCTGAGCATAACTAGAATGG + Intergenic
1132726882 16:1342762-1342784 ATGGCTGAGCAGCAGCAGGTGGG - Exonic
1132767768 16:1543157-1543179 ATGGCTGAGCATGACCAGCACGG + Intronic
1135565504 16:23508590-23508612 AAGGCTGAGCAGAAACAGGCAGG - Intronic
1138200468 16:55084528-55084550 ATGGCAGAGTGGAACAAGGAAGG - Intergenic
1139308079 16:66005139-66005161 ATAGCTGATCAGACCAAGGATGG + Intergenic
1142088291 16:88196366-88196388 ATGGCTTTGCTGAACTAGGCTGG - Intergenic
1143129221 17:4665582-4665604 ATGGCTTAGCAGAAATAGGGGGG - Intergenic
1145212075 17:21021223-21021245 ATGGCTGAGGAGAGAAAGGAGGG + Exonic
1146089918 17:29866683-29866705 ATGGCTGAGGAGAACTGAAATGG + Intronic
1148474954 17:47922277-47922299 GAGGCTGAGCAGGACAAGGAGGG - Intronic
1149374630 17:56031697-56031719 ATGGCTGAGTAAAATGAGGAAGG + Intergenic
1150484427 17:65533814-65533836 CTGGCTGAGCAGACCTAGGTGGG - Intronic
1150610801 17:66731599-66731621 AGGGCTCAGCAGAAAAAGGAAGG - Intronic
1151511641 17:74564476-74564498 ATGGCTGAGCACACCCAGGCTGG - Intergenic
1152054966 17:78017405-78017427 GTGGCGGAGCTGAACAAGGAGGG + Intronic
1153262256 18:3236000-3236022 ATGGCTGAGCAGACTGGGGAGGG + Intergenic
1159890640 18:73949970-73949992 GTGGCTGTGCAGAACCAAGAAGG - Intergenic
1162332855 19:10041072-10041094 ATGGCTGTGCAAAATTGGGAGGG - Intergenic
1162351090 19:10150196-10150218 GTGGCAGAGCAGAAGTGGGAGGG - Intronic
1162658879 19:12154138-12154160 ATGCCTGAACAGAGCCAGGAAGG + Intronic
1163577378 19:18118538-18118560 AGGGCTGGGCAGAACCAGGGAGG + Intronic
1167028640 19:46941310-46941332 TTGGCTGAGAAGAACTACCAGGG - Intronic
925875598 2:8308866-8308888 ATGAATGAGCAAAACTGGGAAGG + Intergenic
926143482 2:10382842-10382864 GTGGCTGGGCAGAAACAGGAAGG - Intronic
927739658 2:25557080-25557102 ATGGCAGAACTGAAGTAGGAAGG + Intronic
927792086 2:26018232-26018254 CTGGCTGAGCTGAACTAGTTGGG - Intergenic
932952781 2:76313813-76313835 ATGGTTCAGCAGAACATGGATGG - Intergenic
933586397 2:84184068-84184090 ATGGCTGAGCAGAAGTTTTAGGG + Intergenic
933958708 2:87394903-87394925 ATGGCTGAGAAGGACTTGGGGGG + Intergenic
934242838 2:90286909-90286931 ATGGCTGAGAAGGACTTGGGGGG + Intergenic
934270338 2:91529774-91529796 ATGGCTGAGAAGGACTTGGGGGG - Intergenic
934969638 2:98752579-98752601 ATGATTGAGAAGCACTAGGATGG + Intergenic
935239034 2:101162199-101162221 ATGAGGGAGCAGAACTAGGCAGG + Intronic
936148567 2:109997713-109997735 AGGGCTGGTCAGAAGTAGGATGG - Intergenic
937230093 2:120393242-120393264 ATGGCTGTCCAGAAGTAGCATGG - Intergenic
937920040 2:127122402-127122424 AGGGAGGAGCAGAAATAGGAGGG - Intergenic
938304855 2:130246184-130246206 CTGCCTGAGCAAAACCAGGAGGG - Intergenic
938449157 2:131401016-131401038 CTGCCTGAGCAAAACCAGGAGGG + Intergenic
938557108 2:132435296-132435318 TAGGCTGAGGAGAACGAGGAAGG - Intronic
940322233 2:152389725-152389747 ATGGCTCAGCAGCACGAGGGCGG + Intronic
941274392 2:163472331-163472353 AAAGCTGAGTAGAACTAGAATGG + Intergenic
943536052 2:189152063-189152085 ATCTCAGAGGAGAACTAGGAAGG + Intronic
945483416 2:210367695-210367717 TAGTCTGAGGAGAACTAGGAAGG + Intergenic
945531153 2:210954631-210954653 AAAGCTGGGCAGAACTAGAAAGG - Intergenic
945912901 2:215669649-215669671 ATGGATGATCAGAACTGAGAAGG - Intergenic
945976648 2:216276295-216276317 AGGGCTCAGCAGGAGTAGGAAGG + Intronic
946914076 2:224498105-224498127 AGGGCTGAGCAGCAGTAGGTTGG - Intronic
947395648 2:229684261-229684283 ATGGCTGAGCTGAACTTTAAAGG + Intronic
948341205 2:237253715-237253737 ATGACTGATCAGAGCTGGGATGG - Intergenic
948648886 2:239426536-239426558 ATGCCTGAGCAGAAACTGGAAGG - Intergenic
1169204180 20:3730859-3730881 GAGGCTGAGCAGAGCCAGGAGGG - Intergenic
1169674980 20:8143237-8143259 AAGGCTGAGAAGAAGTAGGTAGG - Intronic
1169897775 20:10522733-10522755 ATGGCGGGGAAGAACAAGGAGGG - Intronic
1171317632 20:24209521-24209543 TGGGCTGAGCAGAACTGGGGAGG - Intergenic
1172300571 20:33846833-33846855 ATGGCTGAGCTGGACTGGGCTGG - Intronic
1172505703 20:35460761-35460783 ATGGCTGAAAAGAGCTAGCAGGG + Intronic
1173002233 20:39112496-39112518 GTGGCTGAGCAGCTGTAGGAAGG + Intergenic
1173414767 20:42845819-42845841 ATGGCAGAGAAGAACTGGGCAGG + Intronic
1179355060 21:40651294-40651316 ATTACTGAGCACAACTATGAAGG + Intronic
1179475021 21:41637481-41637503 AAGGCAGAGCAGAAAAAGGAAGG - Intergenic
1181350238 22:22250100-22250122 ATGGCTGAGAAGGACTTGGGGGG - Intergenic
1182572202 22:31247953-31247975 ATGGCAGCTCAGAGCTAGGATGG + Intronic
1182971813 22:34586351-34586373 AGGGCTGAGAAGAAGTAGAATGG + Intergenic
950398797 3:12754346-12754368 ATGGCTGTACAGAAAGAGGATGG + Intronic
951445860 3:22779746-22779768 ATGGCTGAGCACAAATGGAAAGG - Intergenic
953043730 3:39277506-39277528 ATGGAGGAGCTGAACAAGGAGGG - Intronic
954463717 3:50642286-50642308 ATGGCTGTGCAGAAACTGGATGG - Exonic
954807807 3:53230452-53230474 ATTGCTGAGCAGAACATGGTAGG - Exonic
955080680 3:55655350-55655372 AGGGCTGGGCAGAAATAGGTAGG - Intronic
955216322 3:56987429-56987451 ACGGCTGAGCAGGAGTAGGAGGG + Intronic
955264231 3:57426052-57426074 ATAGCTGAGCTGAATTTGGAAGG + Intronic
956100540 3:65763431-65763453 CTGGCTGAAAAAAACTAGGAAGG + Intronic
960830478 3:121841173-121841195 ATTGATGAGCAGAACTTTGAAGG + Intronic
961379593 3:126488255-126488277 ATGGCTGTGCAGAACTTCGTGGG - Exonic
961688380 3:128650903-128650925 ATGGCGGCGCCGAACAAGGAAGG + Intronic
962365038 3:134773163-134773185 ATGGGGGAGGAGAACCAGGAAGG - Intronic
964435256 3:156644314-156644336 ATGGCAGAGCAGAGCAAGGGAGG - Intergenic
967269458 3:187720766-187720788 ATGTGTCAGCAGAGCTAGGAGGG + Intronic
968144815 3:196289123-196289145 GTGGCTGAGAAGAAAGAGGATGG + Intronic
969003876 4:4004149-4004171 ATGGCTGGGCAGGTCGAGGAGGG + Intergenic
973035486 4:45401050-45401072 ATGGCTGGGCAAACCCAGGAAGG - Intergenic
973159390 4:46996213-46996235 GTAGCTGTGCAGAAATAGGAAGG + Intronic
974509712 4:62822912-62822934 ATGGATCAGCATCACTAGGAAGG - Intergenic
975049949 4:69850617-69850639 ATAGATGAAAAGAACTAGGAAGG - Intronic
977870582 4:102085579-102085601 CTGGCTGTGCTGATCTAGGATGG + Intergenic
978118109 4:105046891-105046913 ATGGCTGAAGAGCATTAGGATGG - Intergenic
978608796 4:110512888-110512910 ATTGCTGACAAGACCTAGGAGGG + Intronic
979927364 4:126583669-126583691 CTGGCTGAGCAGAAGCAGAAGGG - Intergenic
983350405 4:166579780-166579802 ATGGGTCAGCAGAAATAGAAAGG + Intergenic
983350442 4:166580876-166580898 ATGGGTCAGCAGAAATAGAAAGG - Intergenic
987191415 5:15482390-15482412 GTGGCTGAGTAGAAAAAGGAGGG + Intergenic
987872646 5:23640834-23640856 ATGGCAGAGGAGAACTTGGTGGG - Intergenic
988494375 5:31732498-31732520 AAGGCTGAGCAGAAGGAGGTGGG + Intronic
988897926 5:35698413-35698435 AGGGCTGCCCAGAGCTAGGAGGG + Intronic
993398496 5:87420240-87420262 GTGACTGATCAGAACTAGCAAGG - Intergenic
995427300 5:112039854-112039876 ATGGCAGAGCAGAACTCTGGGGG - Intergenic
996115478 5:119613425-119613447 ATGGCAGACCAGAATTAGAATGG - Intronic
997402976 5:133616834-133616856 ATGGCTGCTCAGATCTAGGGTGG - Intergenic
998640260 5:144002273-144002295 ATAGCTGAGCACAACAAGGTAGG + Intergenic
1001757617 5:174182657-174182679 ATGGCTAGGGAGAAATAGGACGG - Intronic
1005385554 6:25280664-25280686 ATGGCAGAGCTGAAATAGGATGG + Intronic
1011208908 6:84933342-84933364 ATGTCTGAGCATATCTAGGGAGG - Intergenic
1011520426 6:88198286-88198308 TTGGCTGAGCAGGGCTATGAAGG + Intergenic
1012659965 6:101875438-101875460 TTGGCTGAGCAGATATATGATGG - Intronic
1015288098 6:131508192-131508214 ATTGCTGAGCAGGACGGGGAGGG + Intergenic
1016453753 6:144210194-144210216 ATGGGTGAGCTGAACTGGTAAGG - Intergenic
1019885341 7:3899623-3899645 CTGGCTGAGCAGGCCTGGGAGGG - Intronic
1024684348 7:51729135-51729157 GTGGCTGAGAAGGACGAGGAAGG + Intergenic
1025118095 7:56275725-56275747 ATGGCTGTGCAGGAATAGAAAGG + Intergenic
1026202201 7:68224035-68224057 ATGGCTGTGCAGGAATAGAAAGG + Intergenic
1027294075 7:76748354-76748376 AAGGCTGTGGAGAAATAGGAAGG - Intergenic
1034224189 7:149470136-149470158 GTGGATGAGGAGAACAAGGAAGG + Intergenic
1036912037 8:12765716-12765738 ATGGCTGGGCAGAATCAGGGAGG - Intergenic
1038151341 8:24944002-24944024 ATCGGTGTGGAGAACTAGGAAGG - Intergenic
1042504376 8:69543872-69543894 ATGGCTGGGCAGTTCTGGGATGG + Intronic
1042699828 8:71600122-71600144 GTGGCTGCTCAGAAGTAGGAAGG + Intergenic
1042709965 8:71706641-71706663 ATGGCTGTGGAGAACTGGGAAGG + Intergenic
1044326536 8:90865090-90865112 AGGGCGGAGCAGAACAAGCATGG + Intronic
1044387602 8:91607929-91607951 ATGTCTCAGCAGAACCAGGCAGG - Intergenic
1045249936 8:100474760-100474782 AAGTCTGAGCAGAACCTGGAAGG + Intergenic
1049312797 8:141942410-141942432 AGGGCTGAGCAGTGCTAGGTGGG + Intergenic
1050081592 9:1921468-1921490 ATGGCTGAGCAGGACTAGGGTGG - Intergenic
1050452509 9:5798153-5798175 CTGGATGAGAAGAAATAGGATGG - Intronic
1052068486 9:24052522-24052544 AGGGCAGAGCAAAATTAGGAAGG - Intergenic
1055330662 9:75179643-75179665 ATGGCAGAGCAGAAGCAAGAGGG + Intergenic
1056620173 9:88205999-88206021 TTGGCTTAGCAGAACCTGGAAGG + Intergenic
1056813164 9:89780196-89780218 ATGGCTGAGCTGTAGAAGGAAGG - Intergenic
1057288312 9:93778869-93778891 ACGGCTTAGCAGAAGTGGGAGGG + Intergenic
1058773903 9:108265412-108265434 GTGGCTGGGCAGAACAAGGGAGG - Intergenic
1060379396 9:123152723-123152745 ATGGCTGAGCAGAGAGAGGCGGG + Intronic
1060547619 9:124470352-124470374 ATGGCTCAGCAGGACTTAGAGGG - Intronic
1061913152 9:133735384-133735406 CTGGCTGGGCAGATCTGGGAGGG - Intronic
1189699438 X:43701917-43701939 GTTGCTGAGAAGAAATAGGAAGG - Intronic
1190056090 X:47181802-47181824 GTGGGAGAGCAGAACTAGGATGG - Exonic
1191167243 X:57403794-57403816 ATGTCTGAACAGACCTAGGAGGG - Intronic
1195566969 X:106351548-106351570 ATGGCTCAGCAGACCAAGGATGG - Intergenic
1195722867 X:107883359-107883381 ATGCCTCAGCAGAAAAAGGAGGG + Intronic
1195758355 X:108221152-108221174 ATAAATGAGCAGAACTGGGATGG + Intronic
1197169347 X:123413866-123413888 TTGAGAGAGCAGAACTAGGAAGG + Intronic
1198645577 X:138802388-138802410 AAGGGTGAGCAGAAGCAGGATGG - Intronic
1198826259 X:140701250-140701272 ATGCCTCAGCAGAATAAGGAAGG + Intergenic
1199867777 X:151869606-151869628 AGGGCTGAGCAAAACTGGGGTGG - Intergenic
1200252809 X:154562737-154562759 CTGGCTGAGAAGAACTGAGAAGG - Intronic
1200264958 X:154641679-154641701 CTGGCTGAGAAGAACTGAGAAGG + Intergenic
1201498739 Y:14618362-14618384 GAGGGTGAGCAGAAGTAGGATGG - Intronic
1202114668 Y:21459845-21459867 CTGACTCAGCAGAAATAGGAGGG + Intergenic