ID: 1069424313

View in Genome Browser
Species Human (GRCh38)
Location 10:68276392-68276414
Sequence TCAATTCTGTTCACAGCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069424313_1069424315 6 Left 1069424313 10:68276392-68276414 CCAAAGGCTGTGAACAGAATTGA No data
Right 1069424315 10:68276421-68276443 TCACTTCTGAGCCAAAGCACAGG No data
1069424313_1069424316 10 Left 1069424313 10:68276392-68276414 CCAAAGGCTGTGAACAGAATTGA No data
Right 1069424316 10:68276425-68276447 TTCTGAGCCAAAGCACAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069424313 Original CRISPR TCAATTCTGTTCACAGCCTT TGG (reversed) Intergenic
No off target data available for this crispr