ID: 1069431760

View in Genome Browser
Species Human (GRCh38)
Location 10:68342356-68342378
Sequence TAGTTCTACAAGAAGTAGTG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 120}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069431756_1069431760 26 Left 1069431756 10:68342307-68342329 CCTAAAGATGTGCTGCCTTCATA 0: 1
1: 0
2: 1
3: 12
4: 189
Right 1069431760 10:68342356-68342378 TAGTTCTACAAGAAGTAGTGTGG 0: 1
1: 0
2: 0
3: 14
4: 120
1069431759_1069431760 11 Left 1069431759 10:68342322-68342344 CCTTCATAAGATTTGGGTTGATG 0: 1
1: 0
2: 0
3: 7
4: 101
Right 1069431760 10:68342356-68342378 TAGTTCTACAAGAAGTAGTGTGG 0: 1
1: 0
2: 0
3: 14
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069431760 Original CRISPR TAGTTCTACAAGAAGTAGTG TGG Exonic
904181809 1:28671112-28671134 TAGTGCTACAAGATGTAATGAGG - Intronic
916942523 1:169690778-169690800 TAGTTATAAAAGAAGTGGTGGGG + Exonic
917665919 1:177225563-177225585 CAGTTCCACCAGAAGTTGTGAGG + Intronic
922544954 1:226449689-226449711 TATTTCTAAAGGAATTAGTGTGG - Intergenic
923116126 1:230939492-230939514 TAGTCCTACAAAAAGGAGAGTGG + Exonic
923985808 1:239380567-239380589 CAGTTCTAGAAGAAGTAATGGGG - Intergenic
1062912119 10:1217969-1217991 TAGTTCTCCAAGTAATTGTGGGG - Intronic
1068402665 10:56550601-56550623 TAGTTCTACAACAGGGAGAGAGG - Intergenic
1069431760 10:68342356-68342378 TAGTTCTACAAGAAGTAGTGTGG + Exonic
1069649410 10:70033947-70033969 TAGTTCCACAAGAGGCATTGGGG + Intergenic
1069872122 10:71539622-71539644 TAGTTCTCCAAGGAGGAGAGAGG - Intronic
1072292061 10:93973221-93973243 TAGTTTTACATGAGGTTGTGAGG - Intergenic
1073034039 10:100550689-100550711 TAGTGCTAGAAGAAGCTGTGGGG + Exonic
1074349353 10:112720394-112720416 TAGTTTTTCAAGTAGCAGTGAGG + Intronic
1074721449 10:116269296-116269318 TAATTCTAAATGAAGTAATGTGG - Intronic
1077165644 11:1135789-1135811 TAGGTCTACAGGAAGGAATGAGG + Intergenic
1082852476 11:57777647-57777669 TAGATCTGCTAGAAGTAGTATGG - Intronic
1090710594 11:129381335-129381357 TGGTTCTACAAGTAGTTGAGAGG - Intronic
1091566629 12:1653528-1653550 TAGTTTTAAAAGAATGAGTGAGG + Intergenic
1096441386 12:51646245-51646267 TAACTATACAAGAAGTAGAGAGG + Intronic
1097056978 12:56256316-56256338 TAGTTTTCCTAGAAGTAGTAGGG - Intronic
1098546502 12:71717366-71717388 TAGTACTTCATGAAGTAGTTGGG + Intergenic
1099901752 12:88719170-88719192 TACTTCTTCAATTAGTAGTGGGG + Intergenic
1100142095 12:91631772-91631794 TGTCTCTACAAGAATTAGTGGGG - Intergenic
1102614516 12:114141658-114141680 TAGATCTACAGGAACCAGTGTGG + Intergenic
1102835664 12:116056669-116056691 TAATTCTCCAAGAAGTAATCAGG + Intronic
1104611980 12:130236362-130236384 TATTTCTACAAAAAGGAGAGAGG + Intergenic
1107557863 13:41533570-41533592 TTGGTCTACAAGAAGGAGTAGGG - Intergenic
1110164804 13:72428286-72428308 TAGTTTGACAAGAACTAATGTGG - Intergenic
1111689905 13:91550633-91550655 TAGTTCATTAAGAAGTAGCGTGG + Intronic
1112196746 13:97233939-97233961 TAGATCTCCAAGGAGTGGTGTGG - Intronic
1112719393 13:102225757-102225779 TATGTCTCCAAGAAGTAGTCTGG - Intronic
1113204582 13:107901476-107901498 TAGTTCAAAAAGAACTAGTGAGG + Intergenic
1115454227 14:33582935-33582957 TAGGTCCAAAGGAAGTAGTGAGG - Intronic
1117982910 14:61359319-61359341 TAGTTCTACATGCTGGAGTGAGG + Intronic
1118889829 14:69899536-69899558 TAGTTCTACAGGAAGTATAGTGG - Intronic
1125319464 15:38468738-38468760 TAGATCTACAAGTAGGAGTTGGG - Intronic
1127341267 15:58046835-58046857 TGTTTCTAGAAAAAGTAGTGGGG + Intronic
1127404943 15:58633797-58633819 CACTTCTACAAGAAGCAGTGAGG + Intronic
1130293263 15:82623348-82623370 TTGTTTTAGAAGAACTAGTGGGG + Intronic
1130552578 15:84900496-84900518 TGGTTCTACAAAAAGAAATGGGG + Intronic
1130822363 15:87508972-87508994 GAATTCTAAAAGAACTAGTGAGG + Intergenic
1130986194 15:88846149-88846171 TAGTTCTAAGGGAAGTAGCGTGG + Intronic
1139219943 16:65171135-65171157 TGATTCTAAAAGAAGTAGAGTGG + Intergenic
1143335344 17:6167930-6167952 TATGTCTACTAGAAGTAGGGTGG - Intergenic
1150377634 17:64695019-64695041 TGGTTCTACAGGAAGTAGCCAGG + Intergenic
1150777035 17:68089476-68089498 TGGTTCTACAGGAAGTAGCCAGG - Intergenic
1153137788 18:1937149-1937171 TAGTTCTACAAAATGTAGACAGG + Intergenic
1155174795 18:23292568-23292590 CAGTTCTCCAAGAAGTGCTGAGG - Intronic
1155632840 18:27914612-27914634 TATATCTACAAGAAGAATTGTGG - Intergenic
1155804288 18:30146197-30146219 TTGTTTTACAGGAAGTAGAGAGG - Intergenic
1156576647 18:38324683-38324705 TTGTTCTACATAAAGTAGGGAGG - Intergenic
1158660216 18:59380521-59380543 TAGTTCTCCAAGAGCTATTGTGG + Intergenic
1159088569 18:63821321-63821343 TACTTCTGCAAGATGCAGTGAGG + Intergenic
1160613697 18:80108667-80108689 TAGATCTACTACAAGTTGTGTGG - Intergenic
1161896932 19:7089554-7089576 GAGTTCTGCAAGAAATAGTAAGG + Intergenic
1167014381 19:46830802-46830824 CCGTTCTACAGGATGTAGTGGGG + Intergenic
928290583 2:30033703-30033725 TAGTTTGACAAGTAGTAGTGAGG - Intergenic
928713995 2:34039203-34039225 TATTTCTAGAAGAAGTAGGTGGG - Intergenic
929949336 2:46394158-46394180 TATTTCTACAAGCAGAGGTGGGG + Intergenic
931230260 2:60368446-60368468 TAGCTCTGCAAGCAGTAGTGTGG - Intergenic
937359938 2:121222331-121222353 TATTTCTACAAGATTTTGTGTGG - Exonic
938635148 2:133216797-133216819 TAGATCTAGAAGAAGGAGAGTGG + Intronic
938719469 2:134053297-134053319 TAGTTCTACTAGTGGTTGTGAGG - Intergenic
939437122 2:142191984-142192006 TAGTTCTACCAGGAGTAGGAGGG - Intergenic
941508019 2:166371875-166371897 TAGTCCTTCAAGATGTAATGTGG + Intronic
942360876 2:175170207-175170229 TAGTTCTAAGAGAATTAGTGAGG + Intergenic
946198733 2:218057457-218057479 AAGTTCTTCAAGAAATAATGTGG - Intronic
948811554 2:240480954-240480976 GAGTTCCACAAGAAGGACTGCGG - Exonic
1170391298 20:15877630-15877652 AAGTCCTACAAGAAGTCATGAGG + Intronic
1170489609 20:16859299-16859321 TCTTTCTACAAGAAGTAGGTAGG - Intergenic
1174822566 20:53739724-53739746 CAGTGCTACAATAAGTAGTCTGG + Intergenic
1178134875 21:29615607-29615629 TAGTTGTAAAAGGAATAGTGGGG - Intronic
1178368569 21:32008222-32008244 TTGTTTTAAAAGTAGTAGTGAGG - Intronic
949616039 3:5754739-5754761 CAGTTCTGCAAGAAGCAGTCTGG - Intergenic
951915960 3:27801037-27801059 TGGTTCTTCAAGGAGCAGTGGGG + Intergenic
964797392 3:160514170-160514192 TTGTTCTACAGGAAGCAGTGTGG - Exonic
966392048 3:179463238-179463260 TATTTCTAAAAGACGTAGTAGGG - Intergenic
969567927 4:7991113-7991135 TAGTTCTAGGAGAGGGAGTGAGG + Intronic
969890128 4:10252317-10252339 TACTTCATCAAGAAGTAATGTGG - Intergenic
970717922 4:18949109-18949131 GAATTCCACAAGAAGAAGTGGGG + Intergenic
974098664 4:57393126-57393148 CATTTCTACTAGTAGTAGTGTGG - Intergenic
975679669 4:76864140-76864162 TTGTTCTATAACAAGTAATGCGG - Intergenic
978107354 4:104919406-104919428 AAGTTCTGCAGGAAGAAGTGTGG - Intergenic
981642524 4:146961334-146961356 TAGTTCACCAAGAAGTAATTAGG - Intergenic
983187698 4:164719391-164719413 GAGTTTTAAAGGAAGTAGTGGGG - Intergenic
988096344 5:26615815-26615837 TAATTCTATAAGATGTATTGTGG + Intergenic
988170425 5:27647632-27647654 TAGTTCTAAAAGATTTTGTGAGG - Intergenic
988915581 5:35890881-35890903 TAGTTTGACAAGCAGGAGTGGGG + Intergenic
991686968 5:69190116-69190138 TAGTTCTAAAAGAAATGGTAGGG - Intronic
993839771 5:92863758-92863780 AAATTCTACCAGAAGTTGTGCGG + Intergenic
996009442 5:118465765-118465787 AAGTTCTACAAGAGGGAGAGAGG + Intergenic
998594027 5:143509022-143509044 TGGATTTACAAGAAGCAGTGTGG + Intergenic
999270542 5:150294210-150294232 TAGGCCTACATGAAGAAGTGGGG + Intergenic
1002656043 5:180748116-180748138 TAGTTCTTCAAGAAGTCTTCCGG + Intergenic
1003158065 6:3613146-3613168 TAGCACTAGAAGAAATAGTGAGG + Intergenic
1003278371 6:4671634-4671656 TATTTCTAAAGGAAGAAGTGTGG - Intergenic
1005909213 6:30293638-30293660 TAGTTCTTCAAAAAATAGGGAGG - Intergenic
1010338718 6:74722439-74722461 TAGGTCTAAAAGAAATAATGGGG + Intergenic
1011663939 6:89617336-89617358 TAGCTCTACAACCAGTACTGGGG + Intronic
1012604880 6:101145463-101145485 TAGTACTAAATGAAATAGTGAGG - Intergenic
1013499054 6:110729246-110729268 TAGTTCTACAAGCAATGGTTTGG - Intronic
1015110434 6:129586771-129586793 AGGTTCTACAAGAAATAGTGGGG - Intronic
1016369120 6:143353427-143353449 TAGTTCTACAAGAAATGGTAAGG - Intergenic
1016559685 6:145381545-145381567 TAGTAGTACAGAAAGTAGTGAGG - Intergenic
1021272546 7:18608888-18608910 TAGTTCCTCAAGAAGTACGGTGG - Intronic
1022838207 7:34136864-34136886 CTGTTCTCCAAGAAGCAGTGTGG + Intronic
1023375963 7:39555237-39555259 TAGTTCTTAAAGAAGAAGGGAGG - Intergenic
1024977452 7:55126847-55126869 TCATTATACAAAAAGTAGTGTGG + Intronic
1026163010 7:67887124-67887146 TAGTAATACAAAAATTAGTGGGG - Intergenic
1030597693 7:111559905-111559927 TACTTCTACATGAAGTTGTGGGG + Intronic
1031712925 7:125072191-125072213 TAATGGTACAAGAAATAGTGAGG - Intergenic
1032243265 7:130183512-130183534 TAGTTCTAGAAGATGCAGAGTGG + Intronic
1033916539 7:146333244-146333266 TTCTTCTACAAGAAGAAATGGGG - Intronic
1034191323 7:149215618-149215640 TAGTTCTAGAAGAGCCAGTGTGG + Intronic
1036227179 8:6969522-6969544 TAGACCTCCAGGAAGTAGTGGGG - Intergenic
1042126890 8:65547172-65547194 TAGATCTCCAAGAAGTATTGAGG + Intergenic
1043328699 8:79086158-79086180 TAGTTATACAAGAATTATAGAGG - Intergenic
1046657537 8:116911964-116911986 TAGTTATACTAGAAGAATTGTGG + Intergenic
1050749878 9:8924652-8924674 CAGTTCTGCAAGTAGAAGTGAGG - Intronic
1051815370 9:21098609-21098631 TAGTTCTACAATAACGAATGTGG - Intergenic
1053783093 9:41630952-41630974 TTGTGCTACAAGAAGTCGGGGGG - Intergenic
1057986334 9:99718495-99718517 AAGTGATACAAAAAGTAGTGAGG + Intergenic
1058181608 9:101806936-101806958 AAGTGGTACCAGAAGTAGTGTGG + Intergenic
1058331816 9:103770969-103770991 TAGCTCACCAATAAGTAGTGTGG + Intergenic
1060928834 9:127475077-127475099 TAGTTCAGCAAGAATTAGAGAGG + Intronic
1187677009 X:21726287-21726309 GAGTTCTGCGAGAAGAAGTGGGG - Intronic
1188511437 X:30940544-30940566 AAGTTCTAGAAGTAGTGGTGAGG - Intronic
1188966937 X:36565479-36565501 TATCTCTACAAGAGGTACTGAGG - Intergenic
1189398801 X:40646737-40646759 GAGTTCTACAAGAGATACTGGGG - Intronic
1189980644 X:46506887-46506909 TAGCTGTACAAGAAGGAATGAGG + Intronic
1190258662 X:48784516-48784538 TAGTACTATAAGTAGTAGTAGGG + Intergenic
1190956462 X:55199654-55199676 TTGTTCTATAACAAGTAATGCGG + Intronic
1194949971 X:100114015-100114037 TACTTCTGCAAAAAGTAGAGAGG + Intergenic
1195754380 X:108186872-108186894 AAGTTCTTCACGAAGTAGGGTGG + Intronic