ID: 1069438229

View in Genome Browser
Species Human (GRCh38)
Location 10:68405851-68405873
Sequence TATTAACTTGGTATTCAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069438229_1069438231 -5 Left 1069438229 10:68405851-68405873 CCAGTCTGAATACCAAGTTAATA No data
Right 1069438231 10:68405869-68405891 TAATAGATGCAAATTCTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069438229 Original CRISPR TATTAACTTGGTATTCAGAC TGG (reversed) Intronic
No off target data available for this crispr