ID: 1069438389

View in Genome Browser
Species Human (GRCh38)
Location 10:68406850-68406872
Sequence GGGAGGGGCGATGACTTTTC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 752
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 735}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069438389_1069438403 14 Left 1069438389 10:68406850-68406872 CCTGAAAAGTCATCGCCCCTCCC 0: 1
1: 0
2: 1
3: 15
4: 735
Right 1069438403 10:68406887-68406909 CCCGGGAGTGACACCCTGCCTGG 0: 1
1: 0
2: 0
3: 7
4: 145
1069438389_1069438395 -3 Left 1069438389 10:68406850-68406872 CCTGAAAAGTCATCGCCCCTCCC 0: 1
1: 0
2: 1
3: 15
4: 735
Right 1069438395 10:68406870-68406892 CCCCGCCTGCTCCCCGACCCGGG 0: 1
1: 0
2: 4
3: 57
4: 493
1069438389_1069438393 -4 Left 1069438389 10:68406850-68406872 CCTGAAAAGTCATCGCCCCTCCC 0: 1
1: 0
2: 1
3: 15
4: 735
Right 1069438393 10:68406869-68406891 TCCCCGCCTGCTCCCCGACCCGG 0: 1
1: 0
2: 2
3: 38
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069438389 Original CRISPR GGGAGGGGCGATGACTTTTC AGG (reversed) Exonic
900201593 1:1410046-1410068 GGGAGTGGTGATGACTCTTAAGG - Intergenic
900234405 1:1580582-1580604 GGGAGTGGTGATGACTCTTAAGG - Intergenic
900521588 1:3107939-3107961 GGGAGGGGGGCTGAATTGTCAGG + Intronic
901100284 1:6714693-6714715 GGGAGTGGTGATGACTCTTAAGG + Intergenic
901540288 1:9910763-9910785 GGGAGAGGCCATTATTTTTCCGG - Intergenic
902027413 1:13394463-13394485 GGGAGTGGTGATGACTCTTAAGG + Intergenic
902062794 1:13658869-13658891 GGGAGTGGTGATGACTCTTAAGG - Intergenic
902281752 1:15379722-15379744 GGGAGTGGTGATGACTCTTAAGG + Intronic
903162857 1:21502223-21502245 GGGAGTGGTGATGACTCTTAAGG + Intergenic
903531104 1:24031612-24031634 GGGAGTGGTGATGACTCTTAAGG + Intergenic
903582630 1:24383454-24383476 GGGTGGGGCCAGTACTTTTCAGG + Intronic
903607506 1:24585613-24585635 GGGAAGGGAGAGGACTTTCCAGG + Intronic
903746141 1:25588089-25588111 GGGAGTGGTGATGACTCTTAAGG - Intergenic
903748677 1:25604755-25604777 GGGAGTGGTGATGACTCTTAAGG - Intergenic
903789119 1:25880841-25880863 AGGAGGGGAAATGACTTTCCAGG + Intergenic
904269290 1:29338785-29338807 GGGAGTGGTGATGACTCTTAAGG + Intergenic
904544192 1:31255658-31255680 GGGATGGTCGATCCCTTTTCAGG - Intergenic
905192036 1:36243383-36243405 GGGAGTGGTGATGACTCTTAAGG + Intronic
905316065 1:37081935-37081957 GGGAGTGGTGATGACTCTTAAGG - Intergenic
905427753 1:37897542-37897564 GGGAGTGGTGATGACTCTTAAGG - Intronic
905673541 1:39808746-39808768 GGGAGTGGTGATGACTCTTAAGG - Intergenic
905686490 1:39912663-39912685 GGGAGTGGTGATGACTCTTAAGG + Intergenic
906404147 1:45528340-45528362 GGGAGTGGTGATGACTCTTAAGG - Intergenic
906432310 1:45765243-45765265 GGGAGTGGTGATGACTTTTAAGG + Intergenic
906498187 1:46320535-46320557 GGGAGTGGTGATGACTCTTAAGG - Intergenic
906607874 1:47184064-47184086 GGGAGGAGCGATGACCCATCAGG - Intronic
906998725 1:50827437-50827459 GGGAGTGGTGATGACTCTTAAGG - Intronic
907009897 1:50953201-50953223 GGGAGTGGTGATGACTCTTAAGG - Intronic
907120794 1:52006483-52006505 GGGAGTGGTGATGACTCTTAAGG - Intergenic
907465938 1:54636840-54636862 GGGAGTGGTGATGACTCTTAAGG + Exonic
909103401 1:71379164-71379186 GGGAGTGGTGATGACTCTTAAGG - Intergenic
909234139 1:73130004-73130026 GGGAGTGGTGATGACTCTTAAGG + Intergenic
909413158 1:75377325-75377347 GGGAGTGGTGATGACTCTTAAGG - Intronic
909413809 1:75382730-75382752 GGGAGTGGTGATGACTCTTAAGG - Intronic
909651814 1:77983576-77983598 GGGAGTGGTGATGACTCTTAAGG + Intronic
910406708 1:86898970-86898992 GGGAGTGGTGATGACTCTTAAGG + Intronic
910604411 1:89067569-89067591 GGGAGTGGTGATGACTCTTAAGG + Intergenic
910673631 1:89797389-89797411 GGGAGTGGTGATGACTCTTAAGG + Intronic
910777435 1:90891355-90891377 GGGAGTGGTGATGACTCTTAAGG + Intergenic
910815605 1:91288565-91288587 GGGAGTGGTGATGACTCTTAAGG + Intronic
911010682 1:93277488-93277510 GGGAGTGGTGATGACTCTTAAGG + Intronic
911074217 1:93856797-93856819 GGGAGGGGCTCTGATTTTTAGGG - Intergenic
911601948 1:99856630-99856652 GGGAGTGGTGATGACTCTTAGGG + Intronic
912355912 1:109053990-109054012 GGGAGTGGTGATGACTCTTAAGG - Intergenic
912371365 1:109176791-109176813 GGGAGTGGTGATGACTCTTAAGG + Intronic
912660885 1:111529554-111529576 GGGAGTGGTGATGACTCTTAAGG + Intronic
912752245 1:112294834-112294856 GGGAGTGGTGATGACTCTTAAGG - Intergenic
912843927 1:113063118-113063140 GGGAGTGGTGATGACTCTTAAGG + Intergenic
912990357 1:114480287-114480309 GGGAGTGGTGATGACTCTTAAGG - Intronic
913317434 1:117564781-117564803 GGGAGGGGCCAGGGCTTGTCTGG - Intergenic
914374716 1:147062577-147062599 GGGAGTGGTGATGACTCTTAAGG - Intergenic
915401831 1:155627372-155627394 GGGAGTGGTGATGACTCTTAAGG + Intergenic
915402735 1:155635584-155635606 GGGAGTGGTGATGACTCTTAAGG + Intergenic
915480207 1:156179462-156179484 GGGAGTGGTGATGACTCTTAAGG - Intergenic
915571428 1:156747216-156747238 GGGAGGGGCGGTCACATTCCTGG - Intronic
915699829 1:157781288-157781310 TGGATGGGTTATGACTTTTCAGG + Intergenic
915861661 1:159450407-159450429 GGGAGTGGTGATGACTCTTAAGG - Intergenic
915890383 1:159768035-159768057 GGGAGTGGTGATGACTCTTAAGG - Intergenic
916034920 1:160913381-160913403 GGGAGTGGTGATGACTCTTTAGG - Intergenic
916048260 1:161017075-161017097 GGGAGTGGTGATGACTCTTAAGG - Intronic
916105132 1:161424108-161424130 GGGAGTGGTGATGACTCTTAAGG - Intergenic
916223534 1:162466615-162466637 GGGAGTGGTGATGACTCTTAAGG - Intergenic
916759763 1:167805832-167805854 GGGAGTGGTGATGACTCTTAAGG + Intergenic
917127387 1:171699405-171699427 GGGAGGGGAGATGACATTGGAGG - Intergenic
917860216 1:179136518-179136540 GGGAGTGGTGATGACTCTTAAGG - Intronic
918254940 1:182740740-182740762 GGGAGTGGTGATGACTCTTAAGG + Intergenic
918819004 1:189226533-189226555 GGGAGTGGTGATGACTCTTAAGG - Intergenic
919080345 1:192858193-192858215 GGGAGTGGTGATGACTCTTAAGG - Intergenic
920796353 1:209141422-209141444 GGGAGTGGTGATGACTCTTAAGG - Intergenic
921192921 1:212725567-212725589 GGGAGTGGTGATGACTCTTAAGG - Intergenic
922141365 1:222891107-222891129 AGGAGGGGGGATGACTTTTCAGG + Intronic
922278648 1:224101526-224101548 GGGAGTGGTGATGACTCTTAAGG - Intergenic
922305384 1:224340070-224340092 GGGAGTGGTGATGACTCTTAAGG - Intergenic
922306419 1:224349407-224349429 GGGAGTGGTGATGACTCTTAAGG + Intergenic
922992944 1:229931504-229931526 GGGAGTGGTGATGACTCTTAAGG + Intergenic
923468086 1:234267064-234267086 GGGAGTGGTGATGACTCTTAAGG + Intronic
923590080 1:235309986-235310008 GGGAGTGGTGATGACTCTTAAGG - Intronic
923716347 1:236428158-236428180 GGGAGTGGTGATGACTCTTAAGG + Intronic
923901034 1:238326672-238326694 GGGAGTGGTGATGACTCTTAAGG + Intergenic
924666936 1:246082924-246082946 GGGAGTGGTGATGACTCTTAAGG - Intronic
924943795 1:248830776-248830798 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1063776587 10:9272722-9272744 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1063822589 10:9855188-9855210 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1064070614 10:12225947-12225969 GGGAGTGGTGATGACTCTTAAGG + Intronic
1064253872 10:13727726-13727748 GGGAGGGGTGATGGCTGGTCAGG - Intronic
1064731404 10:18334674-18334696 GGGAGGGGTGAGGAGTTTACTGG - Intronic
1065403338 10:25332116-25332138 GGGGGGGGCGAATACATTTCTGG + Intronic
1065553714 10:26893709-26893731 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1065840636 10:29697625-29697647 GGGAGTGGTGATGACTCTTAAGG - Intronic
1066086728 10:31978836-31978858 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1067101410 10:43337442-43337464 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1067331878 10:45330266-45330288 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1067339945 10:45392516-45392538 GGGAGTGGTGATGACTCTTAAGG - Intronic
1067912140 10:50356365-50356387 GGGAGTGGTGATGACTCTTAAGG - Intronic
1068005811 10:51392317-51392339 GGGAGTGGTGATGACTCTTAAGG + Intronic
1068967521 10:62928453-62928475 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1069365920 10:67692548-67692570 GGGAGTGGTGATGACTCTTAAGG - Intronic
1069438389 10:68406850-68406872 GGGAGGGGCGATGACTTTTCAGG - Exonic
1069452057 10:68525908-68525930 GGGAGTGGTGATGACTCTTAAGG - Intronic
1069928697 10:71868844-71868866 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1069929896 10:71875332-71875354 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1070135623 10:73690417-73690439 GGGAGTGGTGATGACTCTTAAGG - Intronic
1070683921 10:78468124-78468146 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1071476861 10:86032633-86032655 GGGAGTGGTGATGACTCTTAAGG - Intronic
1072644936 10:97246462-97246484 TGGAGGGGCTATGAATTTTGAGG - Intronic
1073865717 10:107801341-107801363 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1075016326 10:118912390-118912412 GTGAGGGGTGAAGACTGTTCAGG - Intergenic
1075407152 10:122202845-122202867 GGGAGTGGTGATGACTCTTAAGG + Intronic
1075620026 10:123919867-123919889 GGGTGGGGAGATCACATTTCAGG + Intronic
1075842887 10:125518986-125519008 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1076459211 10:130628192-130628214 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1076556685 10:131327589-131327611 GGGAGGGGGATTGACTTTTCAGG + Intergenic
1077577826 11:3397882-3397904 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1078122546 11:8524124-8524146 GGGAGCGGTGATGACTCTTAAGG - Intronic
1078327438 11:10392015-10392037 GGGAGTGGTGATGACTCTTAAGG + Intronic
1079018446 11:16888654-16888676 GGGAGTGGTGATGACTCTTAAGG - Intronic
1079357307 11:19740370-19740392 GGGAGTGGTGATGACTCTTAAGG - Intronic
1079769948 11:24446325-24446347 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1080488341 11:32734610-32734632 GGGAGTGGTGATGACTCTTAAGG + Intronic
1081806769 11:45895150-45895172 GGGAGGGATGATGGCATTTCTGG + Intronic
1081950050 11:47037572-47037594 GGGAGTGGTGATGACTCTTAAGG + Intronic
1082166264 11:48955023-48955045 GGGAGTGGTGATGACTCTTTAGG + Intergenic
1083120947 11:60510977-60510999 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1083154872 11:60816165-60816187 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1083285433 11:61655715-61655737 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1083372765 11:62194900-62194922 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1083467630 11:62859222-62859244 GGGAGTGGTGATGACTCTTAAGG + Intronic
1083543150 11:63528677-63528699 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1083543446 11:63531020-63531042 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1084338246 11:68475101-68475123 GGGAGTGGTGATGACTCTTAAGG + Intronic
1084745401 11:71166974-71166996 GGGAGTGGTGATGACTCTTAAGG + Intronic
1084830808 11:71767651-71767673 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1084880063 11:72164613-72164635 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1085111783 11:73896484-73896506 GGGAGTGGTGATGACTCTTAAGG + Intronic
1085116356 11:73935772-73935794 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1085159738 11:74328938-74328960 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1085443244 11:76582092-76582114 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1085448906 11:76619650-76619672 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1085791481 11:79500624-79500646 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1085822194 11:79804872-79804894 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1086117096 11:83264421-83264443 GGGAGGGGCTTTCACTTTTTCGG + Intronic
1086341603 11:85853469-85853491 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1086881823 11:92158717-92158739 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1087723696 11:101695302-101695324 GGGAGTGGTGATGACTCTTAAGG - Intronic
1087724627 11:101703800-101703822 GGGAGTGGTGATGACTCTTAAGG - Intronic
1088658783 11:112026510-112026532 GGGAGTGGTGATGACTCTTAAGG + Intronic
1089443530 11:118534203-118534225 GGGAGGGGCGAGGCCTCATCAGG + Intronic
1089472143 11:118729912-118729934 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1089695952 11:120216441-120216463 GGGAGAGGCCCAGACTTTTCTGG + Intronic
1090379208 11:126313335-126313357 GGGAGGGGTGAGGACTTGTTTGG + Intronic
1090798013 11:130152190-130152212 GGGAGGGAAGATGACTTCACAGG - Intergenic
1092059537 12:5537256-5537278 GGGAGTGGTGATGACTTTTAAGG - Intronic
1092142285 12:6192007-6192029 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1092249718 12:6886560-6886582 GGGAGTGGTGATGACTCTTAAGG + Intronic
1092402088 12:8185160-8185182 GGGAGTGGTGATGACTCTTAAGG - Intronic
1092437499 12:8462171-8462193 GGGAGTGGTGATGACTCTTAAGG - Intronic
1092559799 12:9600705-9600727 GGGAGTGGTGATGACTCTTAAGG - Intronic
1092827313 12:12413266-12413288 GGGAGTGGTGATGACTCTTAAGG + Intronic
1094103651 12:26786261-26786283 GGGAGTGGTGATGACTCTTAAGG - Intronic
1094389391 12:29932760-29932782 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1094520332 12:31180429-31180451 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1094623183 12:32099750-32099772 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1095884027 12:47170082-47170104 GGGAGTGGTGATGACTCTTAAGG + Intronic
1096420722 12:51454993-51455015 GGGAGTGGTGATGACTCTTAAGG + Intronic
1096441328 12:51645761-51645783 GGGAGTGGTGATGACTCTTAAGG - Intronic
1096968575 12:55647940-55647962 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1097076831 12:56401067-56401089 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1097330552 12:58328165-58328187 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1097331487 12:58336654-58336676 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1097913997 12:65000777-65000799 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1098041215 12:66355673-66355695 GGGAGAGGGGAAGACTTTGCTGG + Intronic
1098152171 12:67557927-67557949 GGGAGGGGGAGTGACTTCTCTGG + Intergenic
1098242684 12:68484725-68484747 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1098773792 12:74587717-74587739 GGGAGTGGTGATGACTGTTAAGG + Intergenic
1099971468 12:89504413-89504435 GGGAGTGGTGATGACTCTTAAGG - Intronic
1100276267 12:93074642-93074664 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1100606869 12:96158710-96158732 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1101183758 12:102250822-102250844 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1101520684 12:105479265-105479287 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1102135421 12:110570277-110570299 GGGAGTGGTGATGACTCTTAAGG - Intronic
1103092333 12:118106216-118106238 GGGAGTGGTGATGACTCTTAAGG - Intronic
1103350020 12:120277683-120277705 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1103413921 12:120731823-120731845 GGGAGTGGTGATGACTCTTAAGG + Intronic
1103776903 12:123372639-123372661 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1103872410 12:124101332-124101354 GGGAGTGGTGATGACTCTTAAGG + Intronic
1104375877 12:128265806-128265828 GGGTGGGGCGAAGGCTTTGCAGG - Intergenic
1105253224 13:18720231-18720253 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1105267505 13:18835949-18835971 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1105688753 13:22814359-22814381 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1105976632 13:25479676-25479698 GGGAGTGGTGATGACTCTTAAGG + Intronic
1105980204 13:25512071-25512093 GGGAGTGGTGATGACTCTTAAGG + Intronic
1106104956 13:26724625-26724647 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1106129990 13:26932142-26932164 GGGAAGGGCGGTGACTGTTGAGG + Intergenic
1106495507 13:30270720-30270742 GGGAGTGGTGATGACTCTTAAGG - Intronic
1106799575 13:33242558-33242580 GGGAGTGGTGATGACTCTTAAGG - Intronic
1107562808 13:41572602-41572624 GGGAGTGGTGATGACTCTTAAGG - Intronic
1107942311 13:45385714-45385736 GGGAAGGGCCATGACTATTATGG + Intergenic
1109887598 13:68562441-68562463 GGATGGGGCGATGACATTTATGG + Intergenic
1109959834 13:69615583-69615605 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1110922294 13:81102818-81102840 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1111230513 13:85340310-85340332 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1111388686 13:87562232-87562254 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1112055823 13:95690171-95690193 GGGAGTGGTGATGACTCTTAAGG + Intronic
1112420203 13:99241923-99241945 GGGAGTGGTGATGACTCTTAAGG + Intronic
1114154422 14:20084826-20084848 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1114428404 14:22639793-22639815 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1114491907 14:23107880-23107902 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1115847375 14:37554837-37554859 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1115898496 14:38118339-38118361 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1116729078 14:48599014-48599036 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1117010558 14:51467153-51467175 GGGAGTGGCGATGACTCTTAAGG + Intergenic
1117277513 14:54204701-54204723 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1117365603 14:55024789-55024811 GGGAGTGGTGATGACTCTTAAGG - Intronic
1118352069 14:64979294-64979316 GGGAGTGGTGATGACTCTTAAGG + Intronic
1118517321 14:66544774-66544796 GGGAGTGGTGATGACTCTTAAGG + Intronic
1119698502 14:76734166-76734188 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1119797954 14:77416388-77416410 GGGAGTGGTGATGACTCTTAAGG + Intronic
1119841350 14:77795380-77795402 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1120309692 14:82813840-82813862 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1120547476 14:85829346-85829368 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1125651640 15:41321732-41321754 GGGAGTGGTGATGACTCTTAAGG - Intronic
1125740816 15:41963101-41963123 GGGAGTGGTGATGACTCTTAAGG - Intronic
1126210630 15:46097623-46097645 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1126571732 15:50158913-50158935 GGGAGTGGTGATGACTCTTAAGG - Intronic
1128131042 15:65227248-65227270 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1128193929 15:65733893-65733915 GGGAGTGGTGATGACTGTTAAGG - Intronic
1128215600 15:65932268-65932290 GGAAGGGGCCATGACTCCTCAGG + Intronic
1129862523 15:78873422-78873444 GGGAGGGGCGGTGGCTGTTTCGG + Intronic
1130942803 15:88524757-88524779 GGGAGTGGTGATGACTCTTAAGG - Intronic
1130944479 15:88540791-88540813 GGGAGTGGTGATGACTCTTAAGG - Intronic
1132440623 15:101860683-101860705 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1132894066 16:2219521-2219543 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1132921716 16:2399497-2399519 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1133078105 16:3295370-3295392 GGGAGGGGCGGTGACTTGGGCGG - Intronic
1133433034 16:5755094-5755116 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1133495363 16:6312577-6312599 GGGAAGGGAAATGACTTTTGGGG + Intronic
1133769853 16:8861552-8861574 GGGAGGGGTTCTGACATTTCAGG - Intronic
1134471741 16:14532362-14532384 GGGAGTGGTGATGACTCTTAAGG + Intronic
1134483330 16:14636845-14636867 GGGAGTGGTGATGACTCTTAAGG + Intronic
1134750033 16:16618581-16618603 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1134854055 16:17505199-17505221 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1134995442 16:18735059-18735081 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1136930399 16:34412763-34412785 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1136974175 16:34999045-34999067 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1137304127 16:47181990-47182012 GGGAGTGGTGATGACTCTTAAGG - Intronic
1137366560 16:47864698-47864720 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1137388016 16:48058723-48058745 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1137438935 16:48482623-48482645 GCGAGTGGTGATGACTTTTAAGG + Intergenic
1138008977 16:53360571-53360593 GGAAGGGGTGCTGATTTTTCAGG + Intergenic
1138316709 16:56076572-56076594 GGGATGGGTGCTGACATTTCGGG - Intergenic
1139394940 16:66631739-66631761 GGGAGTGGTGATGACTCTTAAGG - Intronic
1140063391 16:71590057-71590079 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1140418919 16:74800099-74800121 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1142825605 17:2507935-2507957 GGGAGTGGTGATGACTCTTAAGG - Intronic
1143195800 17:5075385-5075407 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1143666898 17:8367765-8367787 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1143689772 17:8550949-8550971 GGGAGTGGTGATGACTCTTAAGG - Intronic
1144745532 17:17611630-17611652 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1144860583 17:18298862-18298884 GGGAGTGGTGATGACTCTTAAGG - Intronic
1145031072 17:19505660-19505682 GGGAGTGGTGATGACTCTTAAGG + Intronic
1145174341 17:20685898-20685920 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1145304403 17:21665381-21665403 GGGAGGAGGGATGACCTTCCCGG + Intergenic
1145418317 17:22741996-22742018 GGGAGTGGTGATGACTCTTATGG - Intergenic
1146156013 17:30524025-30524047 GGGAGTGGTGATGACTCTTAAGG - Exonic
1146157589 17:30536601-30536623 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1146181457 17:30700747-30700769 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1146839445 17:36140292-36140314 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1147680708 17:42242933-42242955 GGGAGTGGTGATGACTCTTAAGG - Intronic
1147838734 17:43355185-43355207 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1148016539 17:44525553-44525575 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1148269494 17:46252559-46252581 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1148273745 17:46284320-46284342 GGGAGTGGTGATGACTCTTAAGG + Intronic
1148404530 17:47398660-47398682 GGGAGTGGTGATGACTCTTAAGG - Intronic
1148406664 17:47421436-47421458 GGGAGTGGTGATGACTCTTAAGG - Intronic
1149202325 17:54201813-54201835 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1149641994 17:58208851-58208873 GGGAGTGGTGATGACTCTTAAGG + Intronic
1149950103 17:60976625-60976647 GGGAGTGGTGATGACTCTTAAGG + Intronic
1150214200 17:63457487-63457509 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1150409313 17:64930261-64930283 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1150527535 17:65938226-65938248 GGGAGTGGTGATGACTCTTAGGG - Intronic
1150557898 17:66269780-66269802 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1150686820 17:67327554-67327576 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1150894510 17:69195746-69195768 GGGAGTGGTGATGACTCTTAAGG + Intronic
1151684634 17:75639463-75639485 GGGAGTGGAGAGGACTTTCCTGG + Exonic
1152478874 17:80537034-80537056 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1152873814 17:82774236-82774258 GGGAGTGGTGATGACTCTTAAGG + Intronic
1153422117 18:4917986-4918008 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1154003331 18:10505620-10505642 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1154398052 18:14010143-14010165 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1154440122 18:14382361-14382383 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1158307077 18:56117556-56117578 AGGAGGGGGGATTACTTTTTGGG - Intergenic
1158387603 18:57012830-57012852 GGGAGGTGCGATAACTTGTTTGG - Intronic
1158431154 18:57388844-57388866 GGGAGTGGCAGTGACTATTCAGG - Intergenic
1158647014 18:59256234-59256256 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1158806124 18:60975609-60975631 GGTGGGGACGATGACTCTTCAGG - Intergenic
1159484958 18:69043558-69043580 GGGAGTGGTGATGACTCTTAAGG + Intronic
1159614782 18:70569203-70569225 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1160182329 18:76646262-76646284 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1160521360 18:79510115-79510137 GGGGGGGGCTATGAGTTATCTGG - Intronic
1160706085 19:531074-531096 GGGAGGGGCGAGGGCTTCCCTGG - Intergenic
1162164079 19:8740235-8740257 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1163916992 19:20248520-20248542 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1163937867 19:20466565-20466587 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1164049000 19:21568183-21568205 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1164126176 19:22321258-22321280 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1164153654 19:22575177-22575199 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1164273262 19:23692928-23692950 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1164370387 19:27638296-27638318 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1164424683 19:28130869-28130891 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1164489051 19:28690018-28690040 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1165118769 19:33545745-33545767 GGGAGGGTCATTGACATTTCTGG - Intergenic
1165247279 19:34504886-34504908 GGGAGGGGTGAGGGCTTTGCTGG + Exonic
1165506476 19:36234071-36234093 GGGAGTGGTGATGACTCTTAAGG + Intronic
1165508115 19:36247671-36247693 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1165634775 19:37331630-37331652 GGGAGTGGTGATGACTCTTAAGG - Intronic
1165655735 19:37530510-37530532 GGGAGTGGTGATGACTCTTAAGG + Intronic
1165691377 19:37866416-37866438 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1165727501 19:38123451-38123473 GGGAGTGGTGATGACTCTTAAGG + Intronic
1165844218 19:38807927-38807949 GGGAGTGGTGATGACTCTTAAGG - Intronic
1165851945 19:38855156-38855178 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1165952019 19:39479724-39479746 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1165952359 19:39481418-39481440 GGGAAGGGCAATCACTTGTCTGG - Intronic
1166653615 19:44594335-44594357 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1166688444 19:44809426-44809448 GGGAAGGGGGCTGACTTCTCTGG - Intronic
1166832962 19:45649018-45649040 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1167336548 19:48889875-48889897 GGGAGTGGTGATGACTCTTTAGG - Intronic
1167548228 19:50141672-50141694 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1167588705 19:50390762-50390784 GGGAGTGGTGATGACTCTTAAGG + Intronic
1167818992 19:51908896-51908918 GGGAGTGGTGATGACTCTTAAGG + Intronic
1167833092 19:52043372-52043394 GGGAGTGGTGATGACTCTTAAGG - Intronic
1167876950 19:52421663-52421685 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1167897363 19:52592965-52592987 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1167907878 19:52676935-52676957 GGGAGTGGTGATGACTCTTAAGG - Intronic
1167910546 19:52698445-52698467 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1167913060 19:52719954-52719976 GGGAGTGGTGATGACTTTTAAGG + Intronic
1167924778 19:52812574-52812596 GGGAGTGGTGATGACTCTTAAGG - Intronic
1167970435 19:53186134-53186156 GGGAGTGGTGATGACTCTTAAGG + Intronic
1167975592 19:53223441-53223463 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1167980200 19:53269572-53269594 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1168052333 19:53838865-53838887 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1168213408 19:54908174-54908196 GGGAGTGGTGATGACTCTTAAGG + Intronic
1168219608 19:54950988-54951010 GGGAGTGGTGATGACTCTTAAGG + Intronic
1168658568 19:58148200-58148222 GGGAGTGGTGATGACTCTTAAGG - Intronic
1168695868 19:58404419-58404441 GGGAGTGGTGATGACTCTTAAGG + Intronic
927737098 2:25534190-25534212 GGGAGTGGTGATGACTCTTAAGG + Intronic
927755718 2:25706259-25706281 GGGAGTGGTGATGACTCTTAAGG - Intergenic
927757707 2:25722821-25722843 GGGAGTGGTGATGACTCTTAAGG + Intergenic
927992809 2:27460218-27460240 GGGAGTGGTGATGACTCTTAAGG - Intronic
928082237 2:28321675-28321697 GGGAGGGCCGGTGTCTTTTCAGG + Intronic
928355897 2:30614178-30614200 GGGAGTGGTGATGACTCTTAAGG + Intronic
928416299 2:31094856-31094878 GGGAAGGGAGATGACTTGCCTGG - Intronic
928540047 2:32276288-32276310 GGGAGTGGTGATGACTCTTAAGG + Intergenic
928990208 2:37225557-37225579 GGGAGTGGTGATGACTCTTAAGG - Intronic
929061817 2:37932248-37932270 GGGAGTGGTGATGACTCTTAAGG + Intronic
929208072 2:39321400-39321422 GGGAGTGGTGATGACTCTTAAGG - Intronic
929889854 2:45910029-45910051 GGGGGGGGCGGTGAGTTTACTGG - Intronic
930821632 2:55651583-55651605 GGGAGTGGTGATGACTCTTAAGG - Intronic
930827211 2:55706220-55706242 GGGAGTGGTGATGACTCTTAAGG - Intergenic
932410143 2:71542559-71542581 GGGAGTGGTGATGACTCTTATGG + Intronic
934998386 2:98988366-98988388 GGGAGTGGTGATGACTCTTAAGG + Intergenic
935264649 2:101384020-101384042 GGGAGGGACAATGACATTTATGG + Intronic
935353575 2:102177401-102177423 GGGCGGGGCTATGCCTTGTCTGG + Exonic
935630372 2:105209851-105209873 GGGAGTGGTGATGACTCTTAAGG + Intergenic
936158164 2:110063585-110063607 GGGAGTGGTGATGACTCTTAAGG + Intergenic
936186527 2:110307857-110307879 GGGAGTGGTGATGACTCTTAAGG - Intergenic
937336095 2:121063259-121063281 GGGAGGGGTGGTGACAGTTCGGG + Intergenic
937734821 2:125276764-125276786 GGGAGTGGTGATGACTCTTAAGG + Intergenic
938270137 2:129962671-129962693 GGGAGTGGTGATGACTCTTAAGG + Intergenic
938849632 2:135247731-135247753 GGGAGGTGCAATGACACTTCTGG - Intronic
940338704 2:152556864-152556886 GGGAGGGGGGCAGATTTTTCAGG - Intronic
940817161 2:158310110-158310132 GGGAGTGGTGATGACTCTTAAGG + Intronic
941025240 2:160449634-160449656 GGGAGTGGTGATGACTCTTAAGG - Intronic
941356697 2:164502672-164502694 GGGAAGGGCGATGTGCTTTCTGG + Intronic
941602757 2:167562835-167562857 GGGAGTGGTGATGACTCTTAAGG + Intergenic
941793127 2:169574706-169574728 GGGAGTGGTGATGACTCTTAAGG + Intergenic
942096457 2:172538870-172538892 GGGAGTGGTGATGACTCTTAAGG - Intergenic
942500340 2:176583057-176583079 AGGAGGGAGGATGACTTCTCTGG - Intergenic
943125572 2:183791408-183791430 GGGAGTGGTGATGACTCTTAAGG + Intergenic
943648198 2:190430391-190430413 GGGAGTGGTGATGACTCTTAAGG + Intronic
944255514 2:197619551-197619573 GGGAGTGGTGATGACTCTTAAGG - Intronic
944570993 2:201043237-201043259 GGGAGTGGTGATGACTCTTAAGG - Intronic
944585015 2:201165767-201165789 GGGAGTGGTGATGACTCTTAAGG + Exonic
944593356 2:201238953-201238975 GGGAGTGGTGATGACTCTTAAGG + Intronic
945175182 2:207037064-207037086 GGGAGTGGTGATGACTCTTAAGG - Intergenic
945530925 2:210951396-210951418 GGGAGTGGTGATGACTCTTAAGG - Intergenic
945832361 2:214803132-214803154 GGGAGTGGTGATGACTCTTAAGG - Intronic
946318380 2:218932409-218932431 GGGAGTGGTGATGACTCTTAAGG - Intergenic
946447242 2:219750718-219750740 GGGAGTGGTGATGACTCTTAAGG + Intergenic
946651101 2:221892841-221892863 GGGAGTGGTGATGACTCTTAAGG - Intergenic
947273442 2:228364348-228364370 GGGAGTGGTGATGACTCTTAAGG + Intergenic
947619054 2:231577015-231577037 GGGAGTGGTGATGACTCTTAAGG - Intergenic
947845858 2:233243188-233243210 GGGGGGGGCTATGATTTTTTTGG + Intronic
948589089 2:239038096-239038118 GGGAGTGGCGATGACTCTTAAGG + Intergenic
1169115629 20:3063644-3063666 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1169658833 20:7956438-7956460 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1169991812 20:11512995-11513017 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1170384488 20:15800997-15801019 GGGAGTGGCGATGACTCTTAAGG - Intronic
1171276612 20:23861304-23861326 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1171450787 20:25234545-25234567 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1171497057 20:25562603-25562625 GGGAGTGGTGATGACTCTTAAGG - Intronic
1171521922 20:25782813-25782835 GGGAGGAGGGATGACCTTCCTGG + Intronic
1171554903 20:26073070-26073092 GGGAGGAGGGATGACCTTCCTGG - Intergenic
1172468662 20:35175236-35175258 GCGAGGGGTGAGGAGTTTTCTGG - Intronic
1172479533 20:35262830-35262852 GGGAGTGGTGATGACTCTTAAGG + Intronic
1172640961 20:36440214-36440236 GGGAGGGGAGGTGACTATCCTGG - Intronic
1172729056 20:37070278-37070300 GGGAGTGGTGATGACTCTTAAGG - Intronic
1172819221 20:37717793-37717815 GGGAGTGGTGATGACTCTTAAGG + Intronic
1172910909 20:38408142-38408164 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1173319036 20:41971135-41971157 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1173370354 20:42429430-42429452 GGGAGGAGCTGTGACCTTTCTGG + Intronic
1174020369 20:47525119-47525141 GGGAGTGGTGATGACTCTTAAGG + Intronic
1174218480 20:48935279-48935301 GGGAGTGGTGATGACTCTTAAGG + Intronic
1174317715 20:49715222-49715244 GGGAGGGGAGAGGACTTTGCAGG + Intergenic
1174345050 20:49922928-49922950 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1176348101 21:5769992-5770014 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1176354915 21:5890576-5890598 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1176424466 21:6539521-6539543 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1176496726 21:7554463-7554485 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1176542422 21:8168062-8168084 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1176561373 21:8351107-8351129 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1177005951 21:15672380-15672402 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1177249143 21:18569383-18569405 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1177788191 21:25695166-25695188 GGGAGTGGTGATGACTCTTAAGG + Intronic
1178075907 21:29012581-29012603 GGGAGTGGTGATGACTCTTAAGG - Intronic
1178113351 21:29392377-29392399 GGGAGTGGTGATGACTCTTAAGG + Intronic
1178954022 21:37007046-37007068 GGGAGGGGCGCTCAGTTCTCCGG + Intronic
1179699959 21:43147836-43147858 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1179803450 21:43822838-43822860 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1179814561 21:43897143-43897165 GGGAGTGGTGATGACTCTTAAGG + Intronic
1179822362 21:43944176-43944198 GGGAGGGGCTGTGACATTTGGGG - Intronic
1180837703 22:18938913-18938935 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1180838612 22:18947124-18947146 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1181599007 22:23937702-23937724 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1181642641 22:24211595-24211617 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1182331274 22:29553047-29553069 GGGAGTGGTGATGACTCTTAAGG - Intronic
1182399043 22:30060261-30060283 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1182399926 22:30067317-30067339 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1182708511 22:32305689-32305711 GTGAGGGACGGTGGCTTTTCAGG + Intergenic
1182903895 22:33920586-33920608 GGCCGGGGCGAGGCCTTTTCCGG - Intronic
1182976087 22:34625461-34625483 GGGAGTGGTGATGACTCTTATGG + Intergenic
1183622435 22:38982312-38982334 GGGAGGGGCCATGACTCATAAGG + Intronic
1183748099 22:39703906-39703928 AGGAGGCGCGAGGACTTGTCAGG - Intergenic
1183941142 22:41295507-41295529 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1185048862 22:48543370-48543392 TGGAGGGGAGGTGACCTTTCCGG + Intronic
1203247361 22_KI270733v1_random:84480-84502 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1203287794 22_KI270734v1_random:164212-164234 GGGAGTGGTGATGACTCTTAAGG - Intergenic
949330404 3:2916388-2916410 GGGAGTGGTGATGACTGTTAAGG + Intronic
949551056 3:5113397-5113419 GGGAGTGGTGATGACTCTTAAGG + Intergenic
949648686 3:6129306-6129328 GGGAGTGGTGATGACTCTTAAGG + Intergenic
950282184 3:11718227-11718249 CGTGGGGGAGATGACTTTTCAGG + Intronic
950607146 3:14091891-14091913 GGGAGGGGTGATGACTCTTAAGG + Intergenic
951514680 3:23545369-23545391 GGGAGTGGTGATGACTCTTAAGG + Intronic
952116991 3:30194549-30194571 GGCAGGGGAGATGACTTTAGCGG + Intergenic
952119626 3:30226839-30226861 GAGAAGGGCCAGGACTTTTCGGG - Intergenic
952364801 3:32664683-32664705 GGGAGTGGTGATGACTCTTAAGG - Intergenic
952892727 3:38054002-38054024 GGGAGTGGTGATGACTCTTAAGG - Intronic
953566067 3:44033024-44033046 GGGAGGGGGTGTGACTTTTTGGG + Intergenic
953960056 3:47259773-47259795 GGGAGTGGTGATGACTCTTAAGG - Intronic
953966159 3:47308956-47308978 GGGAGTGGTGATGACTCTTAAGG + Intronic
954060498 3:48062306-48062328 GGGAGTGGTGATGACTCTTAAGG - Intronic
954118847 3:48483274-48483296 GGGAGTGGTGATGACTCTTAAGG + Intronic
954440639 3:50520121-50520143 GGGAGTGGTGATGACTCTTAAGG - Intergenic
955172782 3:56583485-56583507 GGGAGTGGTGATGACTCTTAGGG + Intronic
955669977 3:61393131-61393153 GGGAGTGGTGATGACTCTTAAGG + Intergenic
955938963 3:64129830-64129852 GGGAGGGAAGATGATTTTTGAGG + Intronic
956697298 3:71929354-71929376 GGGAGTGGTGATGACTCTTAAGG - Intergenic
957462553 3:80540389-80540411 GGGAGGGTGGTTGACTTTTAGGG + Intergenic
957789384 3:84919326-84919348 GGGAGTGGTGATGACTCTTAAGG - Intergenic
958047614 3:88304127-88304149 GGGAGTGGTGATGACTCTTAAGG - Intergenic
958943286 3:100337032-100337054 GGGAGTGGTGATGACTCTTAAGG + Intronic
958975799 3:100666835-100666857 GGGAGTGGTGATGACTCTTAAGG + Intronic
959069847 3:101692133-101692155 GGGAGTGGTGATGACTCTTAAGG - Intergenic
959070749 3:101700287-101700309 GGGAGTGGTGATGACTCTTAAGG - Intergenic
959071331 3:101704539-101704561 GGGAGTGGTGATGACTCTTAAGG + Intergenic
960027463 3:113024983-113025005 GGGAGTGGTGATGACTCTTAAGG + Intergenic
960028376 3:113033182-113033204 GGGAGTGGTGATGACTCTTAAGG + Intergenic
960344965 3:116519766-116519788 GGGAGTGGTGATGACTCTTAAGG - Intronic
960918753 3:122724836-122724858 GGGAGTGGTGATGACTCTTAAGG + Intronic
961296719 3:125890690-125890712 GGGAGTGGTGATGACTCTTAAGG - Intergenic
961297539 3:125899024-125899046 GGGAGTGGTGATGACTCTTAAGG - Intergenic
961498194 3:127309505-127309527 GGGAGTGGTGATGACTCTTAAGG - Intergenic
961512624 3:127412368-127412390 GGGAGTGGTGATGACTCTTAAGG + Intergenic
961704548 3:128773889-128773911 GGGAGTGGTGATGACTCTTAAGG - Intronic
961834058 3:129641801-129641823 GGGAGTGGTGATGACTCTTAAGG + Intergenic
962334700 3:134516629-134516651 GGGAGTGGTGATGACTCTTAAGG + Intronic
962583427 3:136818730-136818752 GGGATGCCCGAAGACTTTTCCGG + Intronic
962788072 3:138785625-138785647 GGGAGTGGTGATGACTCTTAAGG - Intronic
963036022 3:141030035-141030057 GGGAGTGGTGATGACTCTTAAGG + Intergenic
963451050 3:145482437-145482459 GGGAGTGGTGATGACTCTTAAGG + Intergenic
966206556 3:177412394-177412416 GGGAGTGGTGATGACTCTTAAGG + Intergenic
966419941 3:179727352-179727374 GGGAGTGGTGATGACTCTTAAGG + Intronic
967025895 3:185563254-185563276 GGGAGTGGTGATGACTCTTAAGG + Intergenic
967026804 3:185571466-185571488 GGGAGTGGTGATGACTCTTAAGG + Intergenic
967038209 3:185664025-185664047 GGAAGGGGCGACGACTTGGCCGG + Intronic
967179705 3:186893459-186893481 GGGAGTGGTGATGACTCTTAAGG - Intergenic
967418934 3:189252077-189252099 GGGAGTGGTGATGACTCTTAAGG + Intronic
967711410 3:192711755-192711777 GGGAGTGGTGATGACTCTTAAGG - Intronic
968095642 3:195928231-195928253 GGGAGTGGTGATGACTCTTAAGG + Intergenic
968316624 3:197731180-197731202 GGGAGTGGTGATGACTCTTAAGG + Intronic
968387272 4:152448-152470 GGGAGTGGTGATGACTCTTAAGG + Intronic
968429732 4:550028-550050 GGGAGTGGTGATGACTCTTAAGG + Intergenic
969384659 4:6836734-6836756 GGGAGCGGTGATGACTCTTAAGG + Intronic
972270670 4:37508865-37508887 GGGAGTGGTGATGACTCTTAAGG + Intronic
972662451 4:41129402-41129424 GGGAGAGGTGATGACATTTCAGG - Intronic
972700506 4:41490465-41490487 GGGAGTGGTGATGACTCTTAAGG + Intronic
973675027 4:53255398-53255420 GGGAGTGGTGATGACTCTTAAGG + Intronic
974517929 4:62941117-62941139 GGGAGTGGTGATGACTCTTAAGG - Intergenic
975246866 4:72129930-72129952 GGGAGTGGTGATGACTCTTAAGG + Intronic
975481493 4:74885572-74885594 GGGTGGGGAGATGACTTAGCAGG + Intergenic
975740426 4:77424240-77424262 GGGAGGGGACATAACTTTTGGGG - Intronic
975848585 4:78548860-78548882 GGGAGTGGTGATGACTCTTAAGG - Intergenic
976149546 4:82078389-82078411 GGGAGTGGTGATGACTCTTAAGG - Intergenic
976976314 4:91169006-91169028 GGGAGTGGTGATGACTCTTAAGG - Intronic
977689988 4:99894944-99894966 GGGAGGAGCCATGGGTTTTCTGG + Intergenic
978825549 4:113018559-113018581 GGTATGTGAGATGACTTTTCAGG + Intronic
978935982 4:114376579-114376601 TGGCTGGGGGATGACTTTTCTGG + Intergenic
979141624 4:117183352-117183374 GGGAGTGGTGATGACTCTTAAGG - Intergenic
979235922 4:118400026-118400048 GGGAGTGGTGATGACTCTTAAGG + Intergenic
979322762 4:119343238-119343260 GGGAGTGGTGATGACTCTTAAGG + Intergenic
979327444 4:119396604-119396626 GGGAGTGGTGATGACTCTTGAGG - Intergenic
979482957 4:121239150-121239172 GGGAGTGGTGATGACTCTTAAGG - Intergenic
979536210 4:121823504-121823526 TGGACGGGCGCTGCCTTTTCCGG + Exonic
979941925 4:126771967-126771989 GGGAGTGGTGATGACTCTTAAGG - Intergenic
980645885 4:135642201-135642223 GGGAGTGGTGATGACTCTTAAGG - Intergenic
982025962 4:151254507-151254529 GGGAGTGGTGATGACTCTTAAGG + Intronic
982053386 4:151525943-151525965 GGGAGTGGTGATGACTCTTAAGG + Intronic
982512880 4:156305468-156305490 GGGAGTGGTGATGACTCTTAAGG + Intergenic
982711193 4:158760120-158760142 GGGAGTGGTGATGACTCTTAAGG - Intergenic
982723619 4:158882805-158882827 GGGAGTGGTGATGACTCTTAAGG - Intronic
982876564 4:160659025-160659047 GGGAGTGGTGATGACTCTTAAGG - Intergenic
983205487 4:164906221-164906243 GGGAGTGGTGATGACTCTTAAGG + Intergenic
983215148 4:164995925-164995947 GGGAGTGGTGATGACTCTTAAGG - Intergenic
984803449 4:183734926-183734948 GGGAGTGGTGATGACTCTTAAGG + Intergenic
985247235 4:187991120-187991142 GGGAGTGGTGATGACTCTTAAGG + Intergenic
985738111 5:1596683-1596705 GGGAGTGGTGATGACTCTTAAGG + Intergenic
986130457 5:4925168-4925190 GGGAGTGGTGATGACTCTTAAGG - Intergenic
986549593 5:8937980-8938002 GGGAGTGGTGATGACTCTTAAGG - Intergenic
987034631 5:14007373-14007395 GGGAGTGGGTGTGACTTTTCTGG - Intergenic
987490825 5:18578694-18578716 GGGAGAGGTGATGACTCTTAAGG - Intergenic
988380017 5:30487359-30487381 GGGAGTGGTGATGACTCTTAAGG + Intergenic
988380936 5:30495845-30495867 GGGAGTGGTGATGACTCTTAAGG + Intergenic
988544594 5:32143259-32143281 GGGAGTGGTGATGACTCTTAAGG - Intronic
988850572 5:35176625-35176647 GGGAGTGGTGATGACTCTTAAGG - Intronic
989021297 5:37012653-37012675 GGGAGTGGTGATGACTCTTAAGG + Intronic
989061351 5:37414968-37414990 GGGAGTGGTGATGACTTTTAAGG + Intronic
989372426 5:40723242-40723264 GGGAGTGGTGATGACTCTTAAGG - Intronic
989737949 5:44731193-44731215 GGGAGTGGTGATGACTCTTAAGG + Intergenic
990298650 5:54428371-54428393 GGGAGTGGCTAAGACTTGTCAGG + Intergenic
990414260 5:55571311-55571333 GGGAGTGGTGATGACTCTTAAGG - Intergenic
990789719 5:59464026-59464048 GGGAGTGGTGATGACTCTTAAGG - Intronic
991376851 5:65976702-65976724 GGGAGTGGTGATGACTCTTACGG + Intronic
991417272 5:66405635-66405657 GGGTGGGGCGTTGCCTTATCTGG - Intergenic
991597787 5:68323288-68323310 GGGAGTGGTGATGACTCTTAAGG + Intergenic
992320238 5:75606539-75606561 GGGAGTGGTGATGACTCTTAAGG + Intergenic
992415681 5:76550539-76550561 GGGAGTGGTGATGACTCTTAAGG + Intronic
992540776 5:77761444-77761466 GGGAGTGGTGATGACTCTTAAGG - Intronic
992864480 5:80943521-80943543 GGGAGTGGTGATGACTCTTAAGG + Intergenic
993496779 5:88616624-88616646 GGGAGTGGTGATGACTCTTAAGG - Intergenic
995772903 5:115691053-115691075 GGGAGTGGTGATGACTCTTAAGG - Intergenic
995878823 5:116821370-116821392 GGGAGTGGTGATGACTCTTAAGG - Intergenic
996163445 5:120195390-120195412 GGGAGTGGTGATGACTCTTAAGG + Intergenic
996386166 5:122912899-122912921 GGGAGTGGTGATGACTCTTAAGG + Intronic
997321501 5:132982578-132982600 GGGAGTGGTGATGACTCTTAAGG + Intergenic
997479920 5:134177141-134177163 GGGAGAGGCGAAAACTCTTCCGG - Intronic
997874601 5:137537180-137537202 GGGAGTGGTGATGACTCTTAAGG + Intronic
998129827 5:139646145-139646167 GGAAGGGGTGTTGACTTGTCTGG - Intergenic
999180848 5:149669713-149669735 GGGAGTGGTGATGACTCTTAAGG + Intergenic
999603769 5:153295760-153295782 GGGAGTGGTGATGACTCTTAAGG + Intergenic
999951738 5:156658412-156658434 GGGAGTGGTGATGACTCTTAAGG + Intronic
999952641 5:156666624-156666646 GGGAGTGGTGATGACTCTTAAGG + Intronic
1000815774 5:165919813-165919835 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1001232138 5:169997581-169997603 GGGAGTGGTGATGACTCTTAAGG + Intronic
1002482832 5:179514669-179514691 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1002501436 5:179650008-179650030 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1002529331 5:179834599-179834621 GGGAGTGGTGATGACTCTTAAGG + Intronic
1002626072 5:180530753-180530775 GGGAGTGGTGATGACTCTTAAGG + Intronic
1002658201 5:180770861-180770883 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1002666213 5:180827505-180827527 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1002722055 5:181267567-181267589 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1003066561 6:2908903-2908925 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1003085215 6:3055039-3055061 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1004152606 6:13134600-13134622 GGGAGTGGTGATGACTCTTAAGG - Intronic
1005063179 6:21796316-21796338 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1005292731 6:24395375-24395397 GGCAGGTTCCATGACTTTTCTGG + Intergenic
1005414384 6:25585734-25585756 GGGAGTGGTGATGACTCTTAAGG + Intronic
1005893506 6:30159131-30159153 GGAAGGGGTGATGACTTACCAGG + Exonic
1006141240 6:31931449-31931471 GGGAGTGGTGATGACTCTTAAGG + Intronic
1006250437 6:32778773-32778795 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1006281642 6:33059136-33059158 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1006399811 6:33810666-33810688 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1007295270 6:40816369-40816391 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1008184222 6:48370850-48370872 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1008582954 6:52922911-52922933 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1009628982 6:66170210-66170232 GGGAGTGGTGATGACTCTTCAGG - Intergenic
1010264281 6:73850614-73850636 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1010270777 6:73914485-73914507 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1010271964 6:73925485-73925507 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1010319482 6:74489341-74489363 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1010415065 6:75602551-75602573 CGCAGGGGAGATTACTTTTCTGG + Exonic
1010513409 6:76745306-76745328 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1010591491 6:77717651-77717673 GGGAGTGGTGATGACTCTTAAGG + Intronic
1010592428 6:77726113-77726135 GGGAGTGGTGATGACTCTTAAGG + Intronic
1010686383 6:78859027-78859049 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1011536522 6:88381827-88381849 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1011967140 6:93173604-93173626 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1012458109 6:99429610-99429632 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1013955650 6:115836957-115836979 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1015221037 6:130803118-130803140 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1015574814 6:134659816-134659838 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1015643419 6:135363234-135363256 GGGAGTGGTGATGACTCTTAAGG + Intronic
1015878103 6:137844709-137844731 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1016123528 6:140373408-140373430 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1016153062 6:140768215-140768237 GGGAGGGGCAAGGAGTTATCTGG - Intergenic
1016550688 6:145276598-145276620 GGGAGGAGCGATAACTATGCAGG + Intergenic
1016802008 6:148178335-148178357 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1017063545 6:150508026-150508048 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1017419965 6:154263431-154263453 GGGAGTGGTGATGACTCTTAAGG + Intronic
1018004430 6:159608336-159608358 TGGAGGTGGGAGGACTTTTCAGG + Intergenic
1019349940 7:549927-549949 GGGAGGGGCCTTGACTTCTTCGG + Exonic
1019976165 7:4583132-4583154 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1019977099 7:4591636-4591658 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1019978035 7:4600139-4600161 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1020831923 7:13103480-13103502 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1021067751 7:16197961-16197983 GGGAGTGGTGATGACTCTTAAGG - Intronic
1021671559 7:23040095-23040117 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1021672108 7:23045480-23045502 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1022164337 7:27742359-27742381 GGGAGTGGTGATGACTCTTAAGG + Intronic
1022542818 7:31154040-31154062 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1023063989 7:36357071-36357093 GAAAAGGGAGATGACTTTTCTGG - Exonic
1023160824 7:37293527-37293549 GGGAGTGGTGATGACTCTTAAGG - Intronic
1023953892 7:44870513-44870535 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1025778379 7:64577928-64577950 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1025851006 7:65243739-65243761 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1026042123 7:66876954-66876976 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1027826840 7:83125693-83125715 GGGCGTGGCGATGACTCTTAAGG - Intronic
1028430662 7:90744196-90744218 GGGAGTGGTGATGACTCTTAAGG + Intronic
1028595574 7:92544595-92544617 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1029279745 7:99427913-99427935 GGGAGTGGTGATGACTCTTAAGG - Intronic
1029334283 7:99887495-99887517 GGGAGTGGTGATGACTCTTAAGG + Intronic
1029449639 7:100633564-100633586 GGGAGAGGTGGGGACTTTTCTGG + Intronic
1029525874 7:101093144-101093166 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1029534797 7:101150559-101150581 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1029966689 7:104748161-104748183 GGGAGTGGTGATGACTCTTAAGG - Intronic
1030725842 7:112923286-112923308 GGGAGTGGTGATGACTCTTAAGG - Intronic
1030760334 7:113342223-113342245 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1031606954 7:123780876-123780898 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1031724628 7:125221876-125221898 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1032474701 7:132203913-132203935 GGGAGGGGTGATCACTTCCCAGG + Intronic
1033185949 7:139226771-139226793 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1033260531 7:139840318-139840340 TGGAGGCGGGATGCCTTTTCCGG - Intronic
1033333210 7:140432198-140432220 GGGAGTGGCGATGACTCTTAAGG - Intergenic
1033375998 7:140762793-140762815 GGGAGTGGTGATGACTCTTAAGG + Intronic
1033565729 7:142575939-142575961 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1034361745 7:150505897-150505919 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1034922614 7:155096479-155096501 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1035349628 7:158237030-158237052 GGGAGTGGTGATGACTCTTAAGG - Intronic
1036291713 8:7498581-7498603 GGGAGTGGTGATGACTCTTAAGG + Intronic
1036292644 8:7507084-7507106 GGGAGTGGTGATGACTCTTAAGG + Intronic
1037429417 8:18794188-18794210 GGGAGTGGTGATGACTCTTAAGG - Intronic
1038229775 8:25689111-25689133 GGGAGGGACCATGGCTTATCAGG + Intergenic
1039392677 8:37194074-37194096 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1039701178 8:39963216-39963238 TGGAGGGGAAGTGACTTTTCTGG - Intronic
1040027650 8:42796400-42796422 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1040124733 8:43724586-43724608 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1040126190 8:43740245-43740267 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1040288314 8:46111590-46111612 GGGAGGGGAGAAGTCTTTTGGGG + Intergenic
1040301566 8:46190721-46190743 GGGATGGGAGATGCCTTTTAGGG - Intergenic
1040413329 8:47176731-47176753 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1041060777 8:54032387-54032409 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1041358350 8:57022990-57023012 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1041676664 8:60547082-60547104 GGGAGTGGTGATGACTCTTAAGG + Intronic
1041920627 8:63179404-63179426 GGGAGTGGTGATGACTCTTAAGG + Intronic
1041979573 8:63841632-63841654 GGGAGAGAGAATGACTTTTCTGG - Intergenic
1042134129 8:65617428-65617450 GGGAGTGGTGATGACTCTTAAGG - Intronic
1043961447 8:86423410-86423432 GGGAGTGGTGATGACTCTTAAGG + Intronic
1044224016 8:89699940-89699962 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1044424831 8:92038944-92038966 GGGAGGGGTGTTAATTTTTCTGG - Intronic
1045235897 8:100351973-100351995 GGGAGTGGTGATGACTCTTAAGG - Intronic
1045524338 8:102929131-102929153 GGGAGTGGTGATGACTCTTAAGG - Intronic
1046599337 8:116298188-116298210 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1048947241 8:139460612-139460634 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1049102347 8:140588752-140588774 GGGAGGGGCGATGGCTCCCCGGG + Intronic
1049379757 8:142306062-142306084 GGGAGTGGTGGTGTCTTTTCAGG + Intronic
1049427344 8:142543341-142543363 GGGAGAGGCGTGGACTTGTCAGG + Intronic
1049557050 8:143287990-143288012 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1049663601 8:143832228-143832250 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1049667146 8:143850409-143850431 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1049844990 8:144796133-144796155 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1049848884 8:144820271-144820293 GGGAGGGGCTGTGACATGTCAGG + Intergenic
1049975885 9:861253-861275 GGGAGTGGTGATGACTCTTAAGG + Intronic
1051280810 9:15441581-15441603 GGGAGTGGTGATGACTCTTAAGG + Intronic
1051430478 9:16976928-16976950 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1051923208 9:22291941-22291963 GGAAGGGCTGATGAATTTTCAGG - Intergenic
1052338617 9:27343283-27343305 GGGAGTGGTGATGACTCTTAAGG - Intronic
1052676612 9:31633585-31633607 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1052771469 9:32694620-32694642 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1052888047 9:33668165-33668187 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1053364424 9:37512459-37512481 GGGAGGGGCGGAGTCTTTTCAGG + Exonic
1054322269 9:63682315-63682337 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1054738396 9:68779935-68779957 GGGAGGGGCGAGGAGTGGTCGGG - Intronic
1055133723 9:72805730-72805752 GGGAGTGGTGATGACTCTTAAGG + Intronic
1055136868 9:72839777-72839799 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1055138474 9:72850609-72850631 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1055157980 9:73087913-73087935 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1056166972 9:83948901-83948923 GGGAGTGGTGATGACTCTTAAGG - Intronic
1056563935 9:87757741-87757763 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1058019242 9:100069099-100069121 GGGAGTGGTGATGACTCTTAAGG - Intronic
1058049778 9:100393674-100393696 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1058806223 9:108594844-108594866 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1059707664 9:116840062-116840084 GGGAGTGGTGATGACTCTTAAGG + Intronic
1060167331 9:121429345-121429367 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1060651137 9:125328386-125328408 GGGAGTGGTGATGACTCTTAAGG + Intronic
1061143268 9:128780958-128780980 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1061554220 9:131356950-131356972 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1061878178 9:133555293-133555315 GGGGGGGGCCATGAATTTTGGGG + Intronic
1061914984 9:133745320-133745342 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1061977396 9:134076370-134076392 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1061979541 9:134093142-134093164 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1062105691 9:134753668-134753690 GGGAAGAACGATGACTTTCCAGG - Intronic
1203463693 Un_GL000220v1:67540-67562 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1185506907 X:638538-638560 GTGAGGGAGGATGACTTTGCTGG + Intronic
1186244703 X:7608187-7608209 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1186328195 X:8502702-8502724 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1187184035 X:16968027-16968049 GGGAGCGGTGATGACTCTTAAGG + Intronic
1187212404 X:17244461-17244483 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1187215762 X:17275092-17275114 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1188086563 X:25906592-25906614 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1189837398 X:45039696-45039718 GGGAGTGGTGATGACTCTTAAGG + Intronic
1189881976 X:45503444-45503466 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1189968119 X:46394853-46394875 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1190241102 X:48658885-48658907 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1192252313 X:69422789-69422811 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1192386999 X:70680390-70680412 GGGAGTGGTGATGACTCTTAAGG - Intronic
1192476855 X:71451662-71451684 GGGAGTGGTGATGACTCTTAAGG + Intronic
1193068242 X:77280111-77280133 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1193372487 X:80713499-80713521 GGGAGTGGTGATGACTCTTAAGG - Intronic
1194200734 X:90950855-90950877 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1195570463 X:106393956-106393978 GGGAGAGGCCAAGACTTTTAAGG - Intergenic
1197186024 X:123588266-123588288 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1197383820 X:125779750-125779772 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1198297721 X:135303444-135303466 GGGAGTGGTGATGACTCTTAAGG + Intronic
1198308542 X:135406337-135406359 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1198602289 X:138296488-138296510 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1199256248 X:145721547-145721569 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1199285502 X:146050137-146050159 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1199855647 X:151756764-151756786 GGGAGGGTTGGTGGCTTTTCTGG - Intergenic
1200280489 X:154773487-154773509 GGGAGTGGTGATGACTCTTAAGG + Intronic
1200731618 Y:6749128-6749150 GGGAGTGGTGATGACTCTTAAGG - Intergenic
1201356738 Y:13104528-13104550 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1202253185 Y:22893745-22893767 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1202406175 Y:24527494-24527516 GGGAGTGGTGATGACTCTTAAGG + Intergenic
1202464607 Y:25142587-25142609 GGGAGTGGTGATGACTCTTAAGG - Intergenic