ID: 1069445669

View in Genome Browser
Species Human (GRCh38)
Location 10:68471514-68471536
Sequence AGTTGAGGAGTTTCGGCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 62}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069445669_1069445678 24 Left 1069445669 10:68471514-68471536 CCAGTGGCCGAAACTCCTCAACT 0: 1
1: 0
2: 1
3: 7
4: 62
Right 1069445678 10:68471561-68471583 AAACAATGAACTGCTCGGCGAGG No data
1069445669_1069445676 1 Left 1069445669 10:68471514-68471536 CCAGTGGCCGAAACTCCTCAACT 0: 1
1: 0
2: 1
3: 7
4: 62
Right 1069445676 10:68471538-68471560 AGGGAGAGAGGTGAAATCAAGGG No data
1069445669_1069445677 19 Left 1069445669 10:68471514-68471536 CCAGTGGCCGAAACTCCTCAACT 0: 1
1: 0
2: 1
3: 7
4: 62
Right 1069445677 10:68471556-68471578 AAGGGAAACAATGAACTGCTCGG No data
1069445669_1069445679 25 Left 1069445669 10:68471514-68471536 CCAGTGGCCGAAACTCCTCAACT 0: 1
1: 0
2: 1
3: 7
4: 62
Right 1069445679 10:68471562-68471584 AACAATGAACTGCTCGGCGAGGG No data
1069445669_1069445675 0 Left 1069445669 10:68471514-68471536 CCAGTGGCCGAAACTCCTCAACT 0: 1
1: 0
2: 1
3: 7
4: 62
Right 1069445675 10:68471537-68471559 TAGGGAGAGAGGTGAAATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069445669 Original CRISPR AGTTGAGGAGTTTCGGCCAC TGG (reversed) Intronic
901836049 1:11925074-11925096 AGTTGAGCAGATTCAACCACTGG + Intronic
902883588 1:19389230-19389252 GTTTGAGGAGTTTCGGGCAGAGG - Intronic
903568125 1:24284320-24284342 GCTTGAGGAGGTTCGGCCACCGG - Intergenic
905674756 1:39817602-39817624 AGTGGAGGAGCTGCGGCTACGGG + Intergenic
914322315 1:146577076-146577098 AGTGGAGGAATTTCAGCCCCAGG + Intergenic
917068168 1:171120523-171120545 AGAAGAGGAGATTCGGTCACAGG - Intergenic
918130988 1:181629219-181629241 TGTTGAGGAGTTTCAGTCTCAGG + Intronic
921516151 1:216094858-216094880 AGGTGAGGAATCTGGGCCACAGG - Intronic
924956193 1:248929775-248929797 AGGTGAGGAGTGTTAGCCACAGG + Intergenic
1063609725 10:7552413-7552435 AATTGAAGAGTTGTGGCCACAGG + Intergenic
1069445669 10:68471514-68471536 AGTTGAGGAGTTTCGGCCACTGG - Intronic
1076961860 10:133769491-133769513 AGGTGAGGAGTGTTAGCCACAGG + Intergenic
1081343281 11:41953456-41953478 TGTTGAGAAGTCTTGGCCACTGG + Intergenic
1088036165 11:105318595-105318617 AGTTCAGGACTTTGGGCAACGGG + Intergenic
1090206543 11:124887443-124887465 AGCTGAGGAGTTTCGGTCCCAGG + Exonic
1095907328 12:47391646-47391668 AGGTGGGGAGTGGCGGCCACAGG - Intergenic
1096212451 12:49776993-49777015 GGTTGGGGAGGTTCAGCCACAGG - Intergenic
1105061752 12:133159035-133159057 AGTTGAGGAAATTGAGCCACAGG - Exonic
1121332084 14:93055991-93056013 AGGTGAGGTGTTTAGGCCACAGG + Intronic
1122645694 14:103192305-103192327 TGCTGAGGAGTTTCTGCCAATGG - Intergenic
1133614885 16:7466904-7466926 ATTTGAGGATTTTCAGCCACAGG + Intronic
1134844562 16:17428984-17429006 AGTTGGGGTTTTTAGGCCACAGG - Intronic
1140011310 16:71134092-71134114 AGTGGAGGAATTTCAGCCCCAGG - Intronic
1140938650 16:79700029-79700051 AGTTGAGGAGTTTTGGAAATAGG - Intergenic
1149324367 17:55514982-55515004 AGTTGAGGACATTCAGGCACAGG + Intergenic
1150623471 17:66825247-66825269 AGTTCAGGAGCTTCAGTCACTGG - Intergenic
1152964423 18:101348-101370 AGGTGAGGAGTGTTAGCCACAGG - Intergenic
1154181388 18:12142600-12142622 AGGTGAGGAGTTTCGGGAATGGG + Intergenic
1154182516 18:12148984-12149006 AGGTGAGGAGTTTCGGGAATGGG - Intergenic
1156832170 18:41504816-41504838 AGAAGAGGAGTTTAGGCCACAGG + Intergenic
1159437052 18:68431764-68431786 AGTTGAAGATTTTCTGTCACAGG + Intergenic
1160654743 19:259314-259336 AGGTGAGGAGTGTTAGCCACAGG - Intergenic
1166656950 19:44619242-44619264 AGTAAAGGTGTTTGGGCCACAGG - Intronic
1168727007 19:58590198-58590220 AGGTGAGGAGTGTTAGCCACAGG + Intergenic
936571548 2:113621008-113621030 AGGTGAGGAGTGTTAGCCACAGG - Intergenic
939445608 2:142306338-142306360 ATTTGAGGATTTTAAGCCACAGG + Intergenic
940304706 2:152213057-152213079 AGTGGAGGTGTTTGGGTCACAGG - Intergenic
944524427 2:200604037-200604059 AGAAGAGGAGTTTCTGCCATTGG + Exonic
946614975 2:221499586-221499608 ATTTGAGCACTTTGGGCCACTGG - Intronic
1168768764 20:400269-400291 ACTTGAGGAATGTCTGCCACTGG + Intergenic
1174755005 20:53149477-53149499 AGAGGAGGAGTTTCTGCCAGGGG + Intronic
1180262447 21:46681982-46682004 AGGTGAGGAGTGTTAGCCACAGG + Intergenic
1185428645 22:50789882-50789904 AGGTGAGGAGTGTTAGCCACAGG + Intergenic
953474807 3:43196056-43196078 AGGTGAGGAGGCTGGGCCACAGG + Intergenic
954802462 3:53195042-53195064 AGTAGAGGAATTTAGGGCACTGG - Intergenic
957225238 3:77434696-77434718 AGTTGATGAGTTCCAGCTACTGG + Intronic
960700298 3:120432795-120432817 ACTTAAGGAGTTAAGGCCACAGG + Intronic
963861397 3:150314069-150314091 AGTTGAGGATTTTTGTGCACTGG + Intergenic
966330548 3:178807423-178807445 AGATGAAGAGGTCCGGCCACTGG - Exonic
981353744 4:143763106-143763128 AGAAGAGGAGTTTAGGACACAGG - Intergenic
985129627 4:186726659-186726681 AGTTGAGGAGTTGCGGCCGCCGG + Intronic
985465091 4:190186972-190186994 AGGTGAGGAGTGTTAGCCACAGG + Intergenic
986053295 5:4110270-4110292 TGTTGAGGGGTTTAGGGCACAGG + Intergenic
989397847 5:40977617-40977639 AGTTGAGGTGTTTATGCCCCTGG - Intronic
989578311 5:43009214-43009236 AGTTGAGGTGTCTAGGCTACAGG - Intergenic
990895455 5:60695493-60695515 AGTGGAGGTGTTTGGGTCACTGG - Intronic
996370349 5:122746717-122746739 ATTTGAGCAGTTTTGGCCAGAGG + Intergenic
996832649 5:127756621-127756643 ATTTGGGGAGGTTCAGCCACAGG + Intergenic
999509155 5:152229799-152229821 AGTTGGGGAATTACTGCCACAGG + Intergenic
999757446 5:154675411-154675433 ACTTGAGGACTTTGGGCAACTGG - Intergenic
1002755132 6:151737-151759 AGGTGAGGAGTGTTAGCCACAGG - Intergenic
1005765682 6:29009479-29009501 AGTTCAGGAGGATTGGCCACAGG - Intergenic
1006791376 6:36703483-36703505 AGTTGAGGAGTTTGGGGCAAAGG + Intronic
1011556069 6:88572638-88572660 AGGAGAGGAGGTTTGGCCACAGG + Intergenic
1018122315 6:160647286-160647308 AGCTGAGGAGTTTGGGCTGCGGG + Intronic
1040062791 8:43118777-43118799 AGTTGGGGAGGCTCAGCCACAGG - Intronic
1055791765 9:79929928-79929950 AGTTGGGGTGTTTGGGCCAGGGG + Intergenic
1058186426 9:101860782-101860804 AATGGAGGAGTTTGGGCCACAGG - Intergenic
1058833247 9:108837984-108838006 AGTTGAGGAGTTTTTGTCTCTGG - Intergenic
1188285439 X:28321233-28321255 AGTTGACTAGTTTCAGCCTCAGG - Intergenic
1188749659 X:33889400-33889422 TGCAGAGGAGTTTCTGCCACTGG - Intergenic