ID: 1069445783

View in Genome Browser
Species Human (GRCh38)
Location 10:68472026-68472048
Sequence GGGCCCCACGTGGAACGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 58}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069445783_1069445785 -6 Left 1069445783 10:68472026-68472048 CCGGCGCGTTCCACGTGGGGCCC 0: 1
1: 0
2: 0
3: 2
4: 58
Right 1069445785 10:68472043-68472065 GGGCCCCTCACCTGAGCAGCAGG 0: 1
1: 0
2: 5
3: 35
4: 277
1069445783_1069445794 27 Left 1069445783 10:68472026-68472048 CCGGCGCGTTCCACGTGGGGCCC 0: 1
1: 0
2: 0
3: 2
4: 58
Right 1069445794 10:68472076-68472098 CTGCCTTTGCTCCCTTGCTTAGG 0: 1
1: 0
2: 2
3: 27
4: 310
1069445783_1069445786 -5 Left 1069445783 10:68472026-68472048 CCGGCGCGTTCCACGTGGGGCCC 0: 1
1: 0
2: 0
3: 2
4: 58
Right 1069445786 10:68472044-68472066 GGCCCCTCACCTGAGCAGCAGGG 0: 1
1: 1
2: 2
3: 26
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069445783 Original CRISPR GGGCCCCACGTGGAACGCGC CGG (reversed) Intronic
900208119 1:1440126-1440148 GGGCCCCAAGTGGCAAGGGCTGG + Exonic
905247518 1:36625410-36625432 GGGCCCCAGGTGGAACAAGGAGG - Intergenic
912515091 1:110212067-110212089 GGCCCCCACGAGGGAGGCGCGGG + Exonic
917962378 1:180155135-180155157 CGCCCCGACGTGGAAGGCGCTGG + Exonic
922738844 1:228004700-228004722 GAGCCCCACGTGGTACAGGCAGG + Intergenic
1064662182 10:17617331-17617353 GCGCCCCATGTGCAGCGCGCAGG + Exonic
1069445783 10:68472026-68472048 GGGCCCCACGTGGAACGCGCCGG - Intronic
1070787544 10:79170762-79170784 AGGCCCAAAGTGGAACGTGCTGG + Intronic
1078895675 11:15594866-15594888 GGGCTCCACAAGGAACGCACTGG - Intergenic
1080551532 11:33376794-33376816 GGGCGCATCGTGGGACGCGCCGG - Intergenic
1081572995 11:44303061-44303083 GGTCCCCACGTGTGCCGCGCTGG + Intronic
1083965771 11:66042865-66042887 TGGCGCCACGTGGCGCGCGCGGG - Exonic
1104649650 12:130522422-130522444 CGTCCCCACGTGGCACCCGCAGG - Intronic
1104675759 12:130710877-130710899 GGACCCCACGTGTGACGTGCGGG - Intronic
1104678541 12:130732305-130732327 CGGCGCCACGTGGAATGAGCAGG + Intergenic
1108988341 13:56622968-56622990 GTGCCCCAAGTGGAATGCTCAGG - Intergenic
1118496525 14:66313173-66313195 GGTCCCAAGGTGGAACACGCTGG + Intergenic
1122342800 14:101039239-101039261 GAGTCCCACGTGGGAAGCGCAGG - Intergenic
1131005005 15:88970927-88970949 GGGCTGCACGTGGCACTCGCGGG - Intergenic
1137053795 16:35734113-35734135 GGGCCCCCCTTGGACCGCCCTGG + Intergenic
1137575041 16:49593925-49593947 TGGCCCCCCATGGAACCCGCAGG + Intronic
1138344712 16:56312762-56312784 GTGCCCCACTTGGAAGGCCCTGG - Intronic
1139956847 16:70697305-70697327 GGTCCCCACGTGGACCGGGTAGG - Intronic
1142050086 16:87952058-87952080 GGGCCCCTCGGGGGACGGGCTGG - Intronic
1142599855 17:1048305-1048327 GGGCCCCACGTGGAGGGGCCTGG - Intronic
1148237075 17:45976140-45976162 GGGGCCCACGGGAAACACGCTGG + Intronic
1149868342 17:60162721-60162743 GGCCCCCACCTGGAACACGATGG - Intronic
1152928866 17:83099997-83100019 GGGCCCCACGGGGGACGCCAGGG + Intergenic
1160859271 19:1230845-1230867 GGGCCCCCCGAGGATGGCGCTGG - Exonic
1161104559 19:2436915-2436937 GTGCCCCAGGTGGAACCCACAGG - Intronic
933923859 2:87075552-87075574 GGGCACCACGTGAAACTCCCGGG + Intergenic
938087015 2:128408415-128408437 GGGCCCCACGTGGGAGACACAGG + Intergenic
938153164 2:128903857-128903879 GGGCTGCACGTGGCACTCGCGGG - Intergenic
946460701 2:219865965-219865987 GTGGCCCACGTGGATAGCGCAGG - Intergenic
947545394 2:231006943-231006965 GGGGCCCCCGGGGAAGGCGCTGG + Intronic
948890098 2:240903345-240903367 GGGCCCCCCGGGGAACGCCCTGG - Intergenic
948899651 2:240949868-240949890 GGGCTCCACGGGGAAGGCCCTGG - Intronic
1168949948 20:1790682-1790704 GGTCCCCACGTGGCCCGAGCAGG + Intergenic
1170226315 20:13995364-13995386 GGGCCCCAGGGCGCACGCGCAGG - Exonic
1175866752 20:62182795-62182817 GGGCACCGGGTGGAACGGGCGGG + Intergenic
1175994181 20:62805017-62805039 GGGCCGCACCTGGAACGAGCTGG - Exonic
1179894920 21:44356294-44356316 GAGCCCCATGTGGAAGGAGCGGG + Intronic
1179895139 21:44357625-44357647 GGGGCCCACGTGGCCAGCGCAGG - Intronic
1180144883 21:45913496-45913518 GGGCCCCTCCTGGGATGCGCAGG - Intronic
1183484838 22:38083154-38083176 GGGCCTCAGGTGGAAGGCGTCGG + Intronic
1185371049 22:50461150-50461172 GCGCCCCACCTGGAATGTGCAGG + Exonic
954609623 3:51937479-51937501 GGGCCCCACTTGGAACATGGTGG - Intronic
954656766 3:52198598-52198620 GGGCCTCACTGGGGACGCGCAGG - Intronic
968515015 4:1012114-1012136 GGGGCCCACGTGGGGCGCGGGGG - Intronic
968573176 4:1353168-1353190 GGGGCCCACCTGGCCCGCGCAGG - Exonic
969362698 4:6674615-6674637 GTGTCCCGCGTGGAAGGCGCTGG + Intergenic
974155287 4:58063585-58063607 GGGCCTCACTTGGAACCTGCAGG - Intergenic
984888518 4:184472826-184472848 GGGCACCAGGTGAAACGCCCGGG - Intronic
1003139052 6:3456432-3456454 GCGCCCCTCGGGGGACGCGCGGG - Exonic
1006379345 6:33688584-33688606 GGGCCCCACATGCAAGGGGCAGG + Intronic
1013538914 6:111088123-111088145 GGGCCCCACGCGGGTCGCCCAGG - Intronic
1019539624 7:1545851-1545873 GGGCCCCACCTGGCACGTGGAGG + Exonic
1033412576 7:141132555-141132577 GGCCCCCAGGTGGCACGTGCAGG - Intronic
1041108925 8:54467393-54467415 TCGCCCCACCTGGAAGGCGCCGG - Intergenic
1062206649 9:135341336-135341358 GGGCTCCACGGGAGACGCGCCGG + Intergenic
1195536579 X:106014447-106014469 AGGCCCCAAGTGGAATGCTCAGG + Intergenic