ID: 1069456664

View in Genome Browser
Species Human (GRCh38)
Location 10:68559595-68559617
Sequence AATGGTGTGAAATGCAATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069456657_1069456664 29 Left 1069456657 10:68559543-68559565 CCGGTTATACTTATGTGTATACG No data
Right 1069456664 10:68559595-68559617 AATGGTGTGAAATGCAATGAGGG No data
1069456656_1069456664 30 Left 1069456656 10:68559542-68559564 CCCGGTTATACTTATGTGTATAC No data
Right 1069456664 10:68559595-68559617 AATGGTGTGAAATGCAATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069456664 Original CRISPR AATGGTGTGAAATGCAATGA GGG Intergenic
No off target data available for this crispr