ID: 1069457739

View in Genome Browser
Species Human (GRCh38)
Location 10:68567085-68567107
Sequence CAGAGTAAAAAGATGGACGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 209}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069457739_1069457746 19 Left 1069457739 10:68567085-68567107 CCAACGTCCATCTTTTTACTCTG 0: 1
1: 0
2: 2
3: 10
4: 209
Right 1069457746 10:68567127-68567149 CTCAAACCACAGATACCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069457739 Original CRISPR CAGAGTAAAAAGATGGACGT TGG (reversed) Intronic
902745018 1:18468042-18468064 CAGAGCAAAAAGAGAGAGGTAGG + Intergenic
902986529 1:20157763-20157785 CAGAGTGAAAAGATGGAAGTTGG + Intergenic
904311269 1:29631130-29631152 CAGAGGAAAGAAATGGACTTTGG + Intergenic
905495750 1:38384515-38384537 CAGAGGAGAAAGATGGAAGGTGG - Intergenic
906050814 1:42870026-42870048 CATAGGAAAAAGATGTAGGTTGG - Intergenic
907817021 1:57928633-57928655 GACAGTAAAAAGATAGAGGTTGG - Intronic
909078176 1:71077944-71077966 CATAGAGAAAAGATGGAAGTTGG + Intronic
917225375 1:172775950-172775972 TAGAGAAACAAGATGGAAGTGGG + Intergenic
918218408 1:182413917-182413939 GAGAGGAAAAAGATGTACATAGG + Intergenic
918405523 1:184208305-184208327 CAGAGGAAAATGGTGGACTTGGG - Intergenic
919251670 1:195064808-195064830 AAAAGTAAAAAGATGGACAAAGG - Intergenic
920049528 1:203154926-203154948 CAGAGAAAAAAGAAGGAAGAGGG - Intronic
921508865 1:216007584-216007606 CAGAGCAAAAAGAAAGACTTTGG + Intronic
921898426 1:220424770-220424792 CAGACTAAAAGGAGGGAAGTTGG - Intergenic
922241201 1:223756428-223756450 CAGAGAAAAGAGATGGGCTTTGG - Intronic
922255086 1:223886791-223886813 CAGAGTAAACAGGTGGAGATGGG - Intergenic
923760690 1:236841084-236841106 CAGCTTAAAAAGCTGAACGTGGG - Intronic
1065252568 10:23831332-23831354 AAGAGTAAAAAGATGGCCTATGG + Intronic
1067839836 10:49666788-49666810 CAGAGTAGGAAGGTGGCCGTGGG - Intergenic
1069457739 10:68567085-68567107 CAGAGTAAAAAGATGGACGTTGG - Intronic
1069769225 10:70887298-70887320 CAGGGAAAAAAGACGGACTTAGG - Intronic
1071614842 10:87065994-87066016 CATAGTGAAAAGATGGGCCTTGG - Intronic
1071990369 10:91095570-91095592 CAGAGTAATAAGATGAAGTTTGG + Intergenic
1075819310 10:125292068-125292090 AAGAGTAAACAGATGGTCTTTGG - Intergenic
1075910284 10:126118785-126118807 CAGAGTAATATAATGGACATTGG - Intronic
1075940330 10:126386080-126386102 CGGAGTAAAAAGAGGGACACAGG + Intronic
1076138153 10:128058857-128058879 CAGAGTCATAAGATGGTCCTTGG + Intronic
1077345368 11:2046537-2046559 CAGAGTATAAAAATGGAGGGTGG - Intergenic
1078054253 11:7994387-7994409 CAAAGTAAACAGATGGCCTTGGG - Intronic
1078849018 11:15147026-15147048 CAAAGTAAAAATATTGAAGTGGG - Intronic
1078915643 11:15776036-15776058 CAGAGTCAAAAGAGGAACCTTGG + Intergenic
1079676753 11:23237589-23237611 CAGATTAAAAAGATGGGAGAGGG + Intergenic
1081060599 11:38470601-38470623 CAGAGTAGAAAGATTAACGGTGG - Intergenic
1081124430 11:39305410-39305432 CAGAGTCTAAAGATGGGGGTGGG + Intergenic
1081531510 11:43963136-43963158 CACAGTAACTGGATGGACGTTGG + Intergenic
1087591604 11:100196120-100196142 CAGAGTAAAAAAATGAAAATGGG + Intronic
1088232709 11:107689037-107689059 CAGAGTACAAAGTGGGAAGTGGG - Intergenic
1088233295 11:107696199-107696221 TAGTGGAAAAAGATGGACTTTGG - Intergenic
1088514471 11:110615124-110615146 CAGACTAAAATGATTGACTTAGG - Intronic
1089905433 11:122033176-122033198 CAAAGGGAAAAGATGGACATTGG + Intergenic
1091342293 11:134825243-134825265 CAGAGGAGAAAGATGTAGGTGGG + Intergenic
1091386062 12:95570-95592 CAGGGAAAAAACATGGAGGTAGG - Intronic
1092953569 12:13529497-13529519 AAGAGTAAACAGAAGGAAGTGGG - Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1098554738 12:71805262-71805284 CAGAGTGATATGATGGACTTTGG - Intergenic
1098784791 12:74738510-74738532 CAGAGTGATAAAATGGACATTGG - Intergenic
1104336838 12:127905517-127905539 CAGAGTGAAAAAATGGACACTGG + Intergenic
1106264366 13:28096885-28096907 AAGATTAAAGAGATGGAGGTAGG - Intronic
1108472075 13:50777408-50777430 CATAGGAAAAAGATGTAGGTTGG - Intronic
1109040160 13:57323896-57323918 CAGAGTAGAAAAATAGACATTGG - Intergenic
1112948662 13:104962464-104962486 CAGAATAAGAAGATGGACCGTGG - Intergenic
1114528968 14:23383379-23383401 AAGAGTAAAATGATGGAGGAGGG - Intronic
1116899195 14:50345769-50345791 GAGAGTAGAAAGATGTACCTGGG - Intronic
1117426439 14:55603246-55603268 CAGAGAAATAAGATGGAACTTGG - Intronic
1117517971 14:56521396-56521418 CAGAGTGATAAAATGGACTTTGG - Intronic
1124784777 15:32669350-32669372 AAAAGTAAAAATATGGACTTGGG - Intronic
1125072553 15:35573359-35573381 CAGAGTAGAAAAATGGACACTGG + Intergenic
1125279545 15:38029161-38029183 CAGAGTAAAAAGAGGCATATGGG + Intergenic
1126382078 15:48059252-48059274 AAGATTAAAAAGATAGAAGTAGG + Intergenic
1129609851 15:77044532-77044554 GAGACCAAAAAGATGGAGGTGGG - Exonic
1130975507 15:88770435-88770457 CAAAGTAAAAAGTTGGAAATAGG - Intergenic
1131610764 15:93960137-93960159 CAGAGGAAAAAGAAAGACATGGG - Intergenic
1134380910 16:13725078-13725100 CAGAGTAATATAATGGACATTGG + Intergenic
1134466504 16:14483478-14483500 CAGAGTAATAAGAAGGACCCTGG - Intronic
1135660372 16:24291497-24291519 GAGAGCAAGAAGATGGAGGTGGG + Intronic
1135751296 16:25060502-25060524 CAGAGTAAAAAGATGTAAGTGGG - Intergenic
1137494079 16:48956177-48956199 CAGATTAAAAAAATGGAAGAGGG + Intergenic
1138875480 16:60943409-60943431 CAGAGGAAAAAAATGGAGGCGGG + Intergenic
1139371690 16:66473155-66473177 CAGAGGAAAGAGATGGGCTTAGG + Intronic
1140464800 16:75172730-75172752 CAGGGTAGAAAGATGGAGGATGG + Intergenic
1144442332 17:15294637-15294659 AAGAGTGAAAAGATGGACATAGG - Intergenic
1146988606 17:37246227-37246249 CAGAGAAAATACATGGAGGTGGG - Intronic
1150927415 17:69547596-69547618 CAGATTAGGAAGATGGACATAGG + Intergenic
1153774163 18:8438206-8438228 CAGAGTAAAGACATGGCCTTGGG - Intergenic
1155719742 18:28996212-28996234 CAGAGTAGAAAGATGGATGCTGG + Intergenic
1156779412 18:40833344-40833366 AAGATTAAAAAAATGGACTTTGG + Intergenic
1159492051 18:69149171-69149193 CAGAGTGGAATGATGGACATTGG + Intergenic
1159820449 18:73134953-73134975 CAGAAGAAAAAGAAGGAAGTGGG - Intergenic
1160900346 19:1424771-1424793 CACAGAACAAAGATGGACATGGG - Intronic
1163966461 19:20751478-20751500 GAGAGTGAAAAGATGGCAGTTGG - Intronic
1164889743 19:31813007-31813029 AAGAGTAAAAGGATGGATATAGG + Intergenic
1168086957 19:54055102-54055124 CACAGTGAGAAGATGCACGTGGG - Intronic
925381672 2:3431922-3431944 CAGATTAAAAAGATGGTGGTGGG - Intronic
926719307 2:15947518-15947540 CAGAATAAACAGATGGAAATGGG + Intergenic
927074316 2:19562043-19562065 CTAAGTAAAAAGATTTACGTAGG + Intergenic
927498897 2:23568910-23568932 CTGAGTAGATAGATGTACGTGGG - Intronic
929355000 2:41012485-41012507 CAGGGTTAAAAGATGGGTGTTGG - Intergenic
935918962 2:107988621-107988643 CAGAGTAAAAACAAAGAGGTGGG + Intronic
941465733 2:165824339-165824361 CAGAATAAGAAGATGGAAGGAGG - Intergenic
941641389 2:167992438-167992460 CAGAGCAGAAAGAAGGATGTGGG + Intronic
942977793 2:182039828-182039850 CAGAGTGAAATAATGGACTTTGG - Intronic
944401544 2:199332365-199332387 CAGTGGAAAAAGAAGGAAGTTGG + Intronic
1168803522 20:659553-659575 AAGAGTCAAAAGATGGAAGATGG - Intronic
1169677377 20:8169190-8169212 CAAAGTAAAGAGATGGCAGTAGG - Intronic
1169784685 20:9346915-9346937 CAGAGGAAAAAGGTGGTCATGGG - Intronic
1170197187 20:13701481-13701503 TAGAGTAAAATGATGGAAGAAGG + Intergenic
1171078286 20:22151459-22151481 CAGAACAAAAAGATGGAGGAAGG - Intergenic
1171190274 20:23154029-23154051 CACAGAGAGAAGATGGACGTTGG - Intergenic
1178469724 21:32881573-32881595 CGGAGTAAGAAGATGAATGTTGG + Intergenic
1179143747 21:38749883-38749905 CCGAGTAAAAAGATGACCTTGGG + Intergenic
1180258039 21:46647343-46647365 CAAAGAAAAAAGTTGTACGTGGG - Intronic
1182262141 22:29081142-29081164 AACAGTAAAAAGAAGGACGGGGG - Intronic
1203238073 22_KI270732v1_random:26673-26695 AAAAGTAAAAAGATGGAGGAGGG - Intergenic
949482534 3:4507584-4507606 CATAAGAAAAAGATGAACGTAGG - Intronic
950800002 3:15542942-15542964 CATAGTAACAATATGGATGTAGG + Intergenic
951147962 3:19252165-19252187 GAGAGAAAAAAGATGCATGTTGG - Intronic
952164002 3:30725741-30725763 CAGAGTAAAAAGATAGAGCATGG - Intergenic
952239888 3:31520648-31520670 CAGAGTAATATAATGGACTTTGG + Intergenic
952304316 3:32132205-32132227 CAGAGTAAAAAGGTAAACATTGG - Intronic
954875907 3:53803102-53803124 CAGAACAAAAAAATGGACCTAGG - Intronic
957409493 3:79819642-79819664 CAGAGGACAAAGCTGGACCTTGG + Intergenic
957979969 3:87496050-87496072 CAAAGAAAAAAGGTGGGCGTTGG - Intergenic
958676187 3:97272067-97272089 CAGAGGAAAAAGAGAGAAGTAGG - Intronic
961495395 3:127287727-127287749 GAGAGAAAAAAGATGGAGGATGG + Intergenic
964530977 3:157667481-157667503 CAGAATTAAAAGATGGAGGAAGG + Intronic
965279749 3:166734680-166734702 CAGAGACAAAAGGTGGAAGTGGG + Intergenic
965297063 3:166961106-166961128 CAGACAAAAAAGATGGAATTTGG - Intergenic
966836030 3:184050147-184050169 CAGCTTAAAAGGAGGGACGTTGG - Intergenic
967367797 3:188707429-188707451 CAGAGCAAAATGATGGACTTTGG - Intronic
969637646 4:8378555-8378577 GGGAGTAAAAAGATGGGCGGTGG - Intronic
969637659 4:8378603-8378625 GGGAGTAAAAAGATGGGCGATGG - Intronic
969976880 4:11112086-11112108 CAGAGGAAACAGATGGCTGTTGG - Intergenic
970186410 4:13459076-13459098 CACAGGAAAAAGATGGAGGCCGG - Intronic
971065292 4:23025153-23025175 CAAACTAAAAATATGGAAGTTGG + Intergenic
971172795 4:24250572-24250594 CACAATAAAAAGAAGGAGGTGGG + Intergenic
971417806 4:26449585-26449607 CAGAGTGGAAAAATGGACATTGG + Intergenic
972663629 4:41142714-41142736 CAGAGAAGAGAGAAGGACGTTGG - Intronic
973173752 4:47178016-47178038 AAGATTAAAAGGATGGATGTTGG + Intronic
973695057 4:53482669-53482691 CAGAGTAATATAATGGACTTTGG + Intronic
977966572 4:103156778-103156800 CAGAGTAAAAAGACAGCCGATGG + Intronic
978723409 4:111941866-111941888 CAGAGTAAAATAATGGAATTTGG + Intergenic
979741053 4:124151686-124151708 GAGAGGAAAAAGATAGAGGTGGG - Intergenic
979887305 4:126045316-126045338 TAGAGCAAAAAGATGGAGGAAGG + Intergenic
981507672 4:145520854-145520876 CAGTGTAAAAAAATGGTAGTGGG + Intronic
982390772 4:154861877-154861899 CAGAGTAAAAACAAGGCCATAGG + Intergenic
982628513 4:157800878-157800900 CAGAGCAATATAATGGACGTTGG - Intergenic
983016763 4:162622886-162622908 CAGACTAGAAAGATAGACGGGGG - Intergenic
988095395 5:26601970-26601992 GAGAGAAAAAAGAAGGAAGTGGG - Intergenic
988301579 5:29436338-29436360 GAGAGTAAAGAAATGGACCTCGG + Intergenic
988348544 5:30070663-30070685 CAGAGTAGTATGATGGACATTGG - Intergenic
989852412 5:46230707-46230729 CAGAGTAAAAAACTGGAGGACGG + Intergenic
991515713 5:67432767-67432789 CAGAGCTAAAATTTGGACGTGGG + Intergenic
991669181 5:69030527-69030549 CAGAGTATAAATAGGGACGTTGG - Intergenic
991763172 5:69943346-69943368 GAGAGTAAAGAAATGGACCTCGG - Intergenic
991784155 5:70174787-70174809 GAGAGTAAAGAAATGGACCTCGG + Intergenic
991842398 5:70818382-70818404 GAGAGTAAAGAAATGGACCTCGG - Intergenic
991876602 5:71175171-71175193 GAGAGTAAAGAAATGGACCTCGG + Intergenic
993038702 5:82787481-82787503 CAGAGTAAAAAGGTGGAGGAAGG + Intergenic
993328236 5:86567687-86567709 CAGAGAGAAAAGATGGCAGTTGG - Intergenic
993421215 5:87702906-87702928 AAGAGTGAAAAGATGAAGGTTGG + Intergenic
996111804 5:119574329-119574351 CAGAGTAATATAATGGACTTTGG - Intronic
996442164 5:123503781-123503803 CAGGGTAAATACATGGACTTTGG + Intergenic
996591168 5:125149290-125149312 CAAAGAAAAAAGATGGGAGTTGG + Intergenic
996686098 5:126282639-126282661 CAGATTGAAAAGAGGGACCTTGG + Intergenic
996746309 5:126849197-126849219 CAGCGTATGAAGATGGACTTAGG + Intergenic
998490206 5:142540019-142540041 CAAAATAAAAAGATGGGGGTTGG + Intergenic
1000803066 5:165752445-165752467 CAGACTAAATAGATAGAAGTAGG - Intergenic
1004658671 6:17690062-17690084 CAGAGTAAAAGTATGGGCTTTGG + Intronic
1008683866 6:53903143-53903165 AAGAGGAACGAGATGGACGTTGG + Intronic
1009004842 6:57772195-57772217 GAGAGTAAAGAAATGGACCTCGG + Intergenic
1009929595 6:70161539-70161561 CAGAGTGATATAATGGACGTTGG + Intronic
1010365471 6:75046127-75046149 CAGAGTGAAAAGATAGCCTTAGG + Intergenic
1010368789 6:75083487-75083509 GAGAGTAAGAAGATGGGAGTGGG + Intergenic
1012015890 6:93850899-93850921 CAGAGTAATATAATGGACATTGG - Intergenic
1016133210 6:140503231-140503253 CAGAGTAAATAGAAAGAGGTGGG + Intergenic
1016164777 6:140927330-140927352 CAAAGAAAAAAGAGGGGCGTAGG + Intergenic
1016944272 6:149514192-149514214 CATAGTGAAAAGAGGGAAGTTGG - Intronic
1017367035 6:153655139-153655161 CAGTGTAAAAAGGTGGATGGGGG - Intergenic
1017841468 6:158226058-158226080 CAGAGTCAAAAGATAGAAGTGGG + Intergenic
1018762078 6:166901519-166901541 CACAGTAAAGAGAAGGCCGTGGG + Intronic
1018762187 6:166902311-166902333 CAGAGTAAAGAGACCGCCGTGGG + Intronic
1021310992 7:19095451-19095473 CAGAGTAAAGGGATGGGCGTGGG + Intronic
1021431395 7:20562272-20562294 CAGAGTAAAAAGGTTGAATTGGG - Intergenic
1023496152 7:40799475-40799497 CAGAGTAAAAGGATAGACAAGGG + Intronic
1023506711 7:40907041-40907063 CAGGGTAGGAAGATGGAAGTAGG + Intergenic
1024579152 7:50787885-50787907 CAGGGTGAAAAGATGGGCGGGGG + Intronic
1024599998 7:50972045-50972067 CAGTTTAAACACATGGACGTTGG - Intergenic
1028647699 7:93116870-93116892 CAGAGTTAAAAAATGTATGTGGG - Intronic
1031914830 7:127553230-127553252 AAGATTAAAAAGATGGATATTGG - Intergenic
1032847690 7:135765898-135765920 CAGAGGAAAAAGAGCGACCTAGG + Intergenic
1033734872 7:144212160-144212182 CAGACTAAAAAGCTTGACTTGGG + Intergenic
1033748183 7:144338809-144338831 CAGACTAAAAAGCTTGACTTGGG - Intergenic
1033772127 7:144564346-144564368 CAGAGTTAACTGATGGACTTTGG - Intronic
1033993004 7:147311151-147311173 GAGAGTAAACAGATGGGCCTAGG + Intronic
1034847523 7:154460373-154460395 CAGAGTGAAGAGACGGAAGTGGG - Intronic
1035487014 7:159233881-159233903 CAGAATAAAAAGAAGAAAGTTGG - Intergenic
1038061892 8:23923104-23923126 CAGAGTCAAAGGATGCAAGTTGG - Intergenic
1042444791 8:68871347-68871369 CAGAAAACAAAGATGGAGGTAGG - Intergenic
1043260390 8:78187645-78187667 CACAGTAGAAAGATGTACGCTGG + Intergenic
1043355625 8:79408877-79408899 CAGAGTGAAATAATGGACATTGG - Intergenic
1048395452 8:134010205-134010227 GAGAGGAAAAGGAAGGACGTGGG + Intergenic
1048957463 8:139548822-139548844 CAGAGAGAAAAGATGGCAGTTGG - Intergenic
1051423884 9:16915379-16915401 CAGAGAAAAGAGATGGAAGAGGG - Intergenic
1052299734 9:26940551-26940573 AAGAGTTAAAAGATGGATGGTGG + Intronic
1053399867 9:37809532-37809554 CAGAATAAAAAGAGGGACATAGG + Intronic
1055093237 9:72383964-72383986 AAGATTAAAAAAATGGATGTGGG - Intergenic
1056558700 9:87711021-87711043 AAGAATAAAAAGATGGAGGCGGG + Intergenic
1059432627 9:114259201-114259223 CAGGGTCAAAAGAGGGACGAGGG + Intronic
1059631921 9:116134238-116134260 AAGATTAAAAAGATGGAGATGGG + Intergenic
1060310286 9:122453429-122453451 CAGAGTACTAAGAGGGACTTAGG - Intergenic
1060938934 9:127532305-127532327 AAAAGTAAAAAGATGGAGGGGGG + Intronic
1187079170 X:15968005-15968027 CAGAGTAAAACAATTGACGGTGG + Intergenic
1187698751 X:21945093-21945115 CAGGGGAAAAAAATGGACATAGG - Intronic
1187923449 X:24228550-24228572 CAGGGTAAATACATGGAAGTGGG + Intergenic
1188922530 X:35995112-35995134 CAGATTAAAAGGATGGAAGCGGG + Intergenic
1188967408 X:36571754-36571776 CACAGAAAAAAAATGGACTTGGG + Intergenic
1190727937 X:53203506-53203528 TAGAGTAAAAAGATGGAAAAGGG - Intronic
1191141753 X:57121772-57121794 CAGACTAAGAAGGTGGAGGTGGG - Intergenic
1193276239 X:79590884-79590906 CAGAGGAAGAAGATAGATGTTGG - Intergenic
1193622859 X:83778023-83778045 CAAAGTAAAAAGAACAACGTTGG - Intergenic
1194388711 X:93289384-93289406 TAGAATAAAAATATGCACGTTGG + Intergenic
1196862289 X:120039673-120039695 CTGAGGAAAGAGATGGTCGTTGG + Intergenic
1196880813 X:120196671-120196693 CTGAGGAAAGAGATGGTCGTTGG - Intergenic
1197044073 X:121975304-121975326 CAGAGTAAACTGATGGTCCTTGG + Intergenic
1197922293 X:131608329-131608351 CAGAGATAAAAGATGGTCGAAGG - Intergenic
1198091552 X:133336026-133336048 CAGACTAAAAAGATGGTGGTAGG - Intronic
1199194478 X:145011251-145011273 CAGTTTGACAAGATGGACGTTGG + Intergenic
1199404623 X:147442640-147442662 GAGAGTAATATGATGGACTTTGG + Intergenic
1199785280 X:151099654-151099676 CATAGGAAAAAGATGGAAGCTGG - Intergenic
1199915944 X:152341048-152341070 CAGAGTGATAAAATGGACTTTGG - Intronic