ID: 1069469676

View in Genome Browser
Species Human (GRCh38)
Location 10:68676709-68676731
Sequence CTGGCCCACATCAATTTTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069469672_1069469676 13 Left 1069469672 10:68676673-68676695 CCAAAGTGCTGGGATTATAGATG 0: 494
1: 12608
2: 100895
3: 234440
4: 258097
Right 1069469676 10:68676709-68676731 CTGGCCCACATCAATTTTTGAGG No data
1069469669_1069469676 20 Left 1069469669 10:68676666-68676688 CCGCCTCCCAAAGTGCTGGGATT 0: 3798
1: 3826
2: 2729
3: 1935
4: 2347
Right 1069469676 10:68676709-68676731 CTGGCCCACATCAATTTTTGAGG No data
1069469670_1069469676 17 Left 1069469670 10:68676669-68676691 CCTCCCAAAGTGCTGGGATTATA 0: 26361
1: 319744
2: 258545
3: 142388
4: 133448
Right 1069469676 10:68676709-68676731 CTGGCCCACATCAATTTTTGAGG No data
1069469665_1069469676 26 Left 1069469665 10:68676660-68676682 CCTCCTCCGCCTCCCAAAGTGCT 0: 1456
1: 154282
2: 177478
3: 114490
4: 72917
Right 1069469676 10:68676709-68676731 CTGGCCCACATCAATTTTTGAGG No data
1069469671_1069469676 14 Left 1069469671 10:68676672-68676694 CCCAAAGTGCTGGGATTATAGAT 0: 541
1: 13847
2: 120394
3: 333716
4: 226827
Right 1069469676 10:68676709-68676731 CTGGCCCACATCAATTTTTGAGG No data
1069469667_1069469676 23 Left 1069469667 10:68676663-68676685 CCTCCGCCTCCCAAAGTGCTGGG 0: 1984
1: 207124
2: 260678
3: 184458
4: 204909
Right 1069469676 10:68676709-68676731 CTGGCCCACATCAATTTTTGAGG No data
1069469664_1069469676 27 Left 1069469664 10:68676659-68676681 CCCTCCTCCGCCTCCCAAAGTGC 0: 65
1: 9168
2: 231903
3: 271683
4: 180620
Right 1069469676 10:68676709-68676731 CTGGCCCACATCAATTTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069469676 Original CRISPR CTGGCCCACATCAATTTTTG AGG Intronic
No off target data available for this crispr