ID: 1069473876

View in Genome Browser
Species Human (GRCh38)
Location 10:68716307-68716329
Sequence AGCTTCGGCTAGCAAGGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069473872_1069473876 27 Left 1069473872 10:68716257-68716279 CCAGTAGCATGCACAAAGTTGAT No data
Right 1069473876 10:68716307-68716329 AGCTTCGGCTAGCAAGGCGCTGG No data
1069473871_1069473876 28 Left 1069473871 10:68716256-68716278 CCCAGTAGCATGCACAAAGTTGA No data
Right 1069473876 10:68716307-68716329 AGCTTCGGCTAGCAAGGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069473876 Original CRISPR AGCTTCGGCTAGCAAGGCGC TGG Intergenic
No off target data available for this crispr