ID: 1069482252

View in Genome Browser
Species Human (GRCh38)
Location 10:68794378-68794400
Sequence TTGTATATTCATTCAGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069482248_1069482252 15 Left 1069482248 10:68794340-68794362 CCTAAATAGGTATTGTTGGCAAT No data
Right 1069482252 10:68794378-68794400 TTGTATATTCATTCAGTGGATGG No data
1069482250_1069482252 -9 Left 1069482250 10:68794364-68794386 CCAGAGGAAAATAATTGTATATT No data
Right 1069482252 10:68794378-68794400 TTGTATATTCATTCAGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069482252 Original CRISPR TTGTATATTCATTCAGTGGA TGG Intergenic
No off target data available for this crispr