ID: 1069485563

View in Genome Browser
Species Human (GRCh38)
Location 10:68820581-68820603
Sequence GAAAATGTACATATGCACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069485563_1069485564 -3 Left 1069485563 10:68820581-68820603 CCATGGTGCATATGTACATTTTC No data
Right 1069485564 10:68820601-68820623 TTCTTTATCCAATCTGTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069485563 Original CRISPR GAAAATGTACATATGCACCA TGG (reversed) Intergenic
No off target data available for this crispr