ID: 1069486518

View in Genome Browser
Species Human (GRCh38)
Location 10:68827415-68827437
Sequence AGGCCGGCGGAGCGCTCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 99}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069486518_1069486526 9 Left 1069486518 10:68827415-68827437 CCTCCAGAGCGCTCCGCCGGCCT 0: 1
1: 0
2: 0
3: 11
4: 99
Right 1069486526 10:68827447-68827469 CGCCCCACCCCCGGCCCGCCAGG 0: 1
1: 0
2: 14
3: 100
4: 799
1069486518_1069486524 0 Left 1069486518 10:68827415-68827437 CCTCCAGAGCGCTCCGCCGGCCT 0: 1
1: 0
2: 0
3: 11
4: 99
Right 1069486524 10:68827438-68827460 AAGCACGGCCGCCCCACCCCCGG 0: 1
1: 0
2: 0
3: 24
4: 171
1069486518_1069486533 18 Left 1069486518 10:68827415-68827437 CCTCCAGAGCGCTCCGCCGGCCT 0: 1
1: 0
2: 0
3: 11
4: 99
Right 1069486533 10:68827456-68827478 CCCGGCCCGCCAGGCGCAGTCGG 0: 1
1: 0
2: 0
3: 3
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069486518 Original CRISPR AGGCCGGCGGAGCGCTCTGG AGG (reversed) Intergenic