ID: 1069490798

View in Genome Browser
Species Human (GRCh38)
Location 10:68858806-68858828
Sequence TCTCTCCTACTGATGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 176}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069490798_1069490803 12 Left 1069490798 10:68858806-68858828 CCCTCTTCCATCAGTAGGAGAGA 0: 1
1: 0
2: 0
3: 22
4: 176
Right 1069490803 10:68858841-68858863 TGCAGTTTCTGTGATGCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069490798 Original CRISPR TCTCTCCTACTGATGGAAGA GGG (reversed) Intronic
900001504 1:17249-17271 TCTCTCTTGCTGATGGACAAGGG + Intergenic
900021223 1:187771-187793 TCTCTCTTGCTGATGGACAAGGG + Intergenic
902288772 1:15423291-15423313 TCTGCCCCACTGATGGATGAGGG - Intronic
903130754 1:21278155-21278177 TCTATTCTTCTGATGGCAGATGG - Intronic
903178135 1:21592595-21592617 TCTTTCCTCCTGCTGGAAGTGGG + Intergenic
904368692 1:30034879-30034901 TCAGTCCTAGTGATGGACGAGGG + Intergenic
905802844 1:40856473-40856495 TCTCTCCATTGGATGGAAGAAGG + Intergenic
906801991 1:48745914-48745936 TCTCCCCTACTAAAGGAGGAGGG + Intronic
907272158 1:53297510-53297532 TGTCGCCTGCTGATGGATGATGG - Intronic
907484654 1:54768836-54768858 TCTCTCCTTACGATGGATGAGGG - Intergenic
908408781 1:63842715-63842737 TCACTGCTACTCATGGAAGCAGG - Intronic
908900150 1:68947138-68947160 AGTCTCCTACTGAAGGAAGAAGG - Intergenic
915230341 1:154441259-154441281 ACTCTCCTTCTATTGGAAGATGG + Intronic
916329792 1:163601957-163601979 TCTTTCTGACTGGTGGAAGAAGG + Intergenic
917109825 1:171535801-171535823 TATCTCCTAGAAATGGAAGATGG - Intronic
917653710 1:177104805-177104827 TTCCTCTTACTGATAGAAGAAGG - Intronic
918227181 1:182494621-182494643 TCTCTGATACTGATGGTAAATGG + Intronic
922124730 1:222711728-222711750 CCTTTCCTACGCATGGAAGAAGG + Intronic
922188596 1:223297515-223297537 TGTCTCCTACTGAAGCAGGAAGG + Intronic
922196807 1:223365474-223365496 TCTCACATACTGATGGTAGTTGG + Intergenic
1063863531 10:10339557-10339579 TCCATCATACTCATGGAAGAGGG + Intergenic
1066619447 10:37329428-37329450 TATTTCTTACTGATGTAAGACGG - Intronic
1068365464 10:56044056-56044078 TCTCTCCTACACATAGAAGGAGG - Intergenic
1069490798 10:68858806-68858828 TCTCTCCTACTGATGGAAGAGGG - Intronic
1070755094 10:78987178-78987200 TCCATCCTAGTGATGGAAGCTGG + Intergenic
1072378699 10:94843093-94843115 TCTCACCCAGTGATGGTAGAGGG - Intronic
1073175670 10:101555476-101555498 TCTCTCCTGCTGATGGAAATGGG + Exonic
1074087715 10:110221238-110221260 TCTATCAAACTGATGGAATAAGG - Intronic
1074998620 10:118778919-118778941 TCTCTCCCACTGTTCGATGAGGG + Intergenic
1076174849 10:128360516-128360538 TCTGTCCTACTGAAGGAAGGAGG - Intergenic
1077754945 11:5017274-5017296 TGTATTCTACTGATGTAAGATGG - Intergenic
1081996058 11:47364776-47364798 CCTCTCCAAGTGATGGATGATGG - Intronic
1084280385 11:68086533-68086555 TCTCTAATACTGAGGGAAGTAGG + Intronic
1085218992 11:74856945-74856967 GGTCTCCTACTGCTGGGAGAGGG + Intronic
1088068088 11:105745988-105746010 TCTCTACTAATATTGGAAGAGGG - Intronic
1090427597 11:126619547-126619569 TCTCTTCTACTGATCAAAGTTGG + Intronic
1091374589 12:17364-17386 TCTCTCTTGCTGATGGACAAGGG + Intergenic
1094004895 12:25738845-25738867 TCTCTCTGCCTGATGGAAGGAGG + Intergenic
1094648189 12:32347970-32347992 TCTCTCTTACTGTGGGAAGAAGG - Intronic
1096671315 12:53199797-53199819 TTTCTCCTAATGTTGGAAGCTGG - Intronic
1097357660 12:58620394-58620416 TCTCTCATAATCATGGCAGAGGG - Intronic
1098791298 12:74827429-74827451 ACACTCCTATAGATGGAAGATGG - Intergenic
1100680356 12:96913067-96913089 CCTCTCCCACTGAGGGAAAATGG - Intronic
1100806584 12:98291987-98292009 TCTCTCCCACTGAGTGGAGAGGG - Intergenic
1101239433 12:102823917-102823939 TCTCTCCTTCTGGTGGAAGGTGG - Intergenic
1103254555 12:119529751-119529773 TCCCTCCCACAGAGGGAAGAGGG - Intronic
1104000667 12:124857848-124857870 TCTCTCCTGGACATGGAAGAAGG + Intronic
1106690764 13:32113668-32113690 TCTGTGCTCCTGATGAAAGAGGG - Intronic
1107249141 13:38336867-38336889 TCTCTCCTATTGATGTCAGATGG + Intergenic
1108256728 13:48618351-48618373 TCTGTCCTACTGCTGGAACATGG - Intergenic
1108749402 13:53432169-53432191 TCTCTCCGAGTGATGACAGACGG + Intergenic
1110449378 13:75624381-75624403 TCTCTCCTACAAATGAGAGAAGG - Intronic
1111980785 13:95013211-95013233 TCTCCTCTCATGATGGAAGAAGG + Intergenic
1114391101 14:22309502-22309524 CTGCTCCTGCTGATGGAAGAGGG + Intergenic
1119947155 14:78706866-78706888 TCTCTCCTGGTGATGAGAGATGG + Intronic
1120031730 14:79649336-79649358 GCTCTTCTCCTGATGGAAGAGGG + Intronic
1125456776 15:39868083-39868105 TATCTCTTAATGATGGTAGAAGG - Intronic
1125580980 15:40785590-40785612 TCTCCTCTACTTCTGGAAGAGGG + Intronic
1126921488 15:53530819-53530841 TTTCTCCTACTGATTCAAGAGGG - Intronic
1128240332 15:66097022-66097044 TCTGTGCTACTCATGGAGGACGG + Intronic
1128250983 15:66164194-66164216 TCTCTGCCACTAATAGAAGATGG - Intronic
1132408467 15:101559638-101559660 CCACTCCCACTGATGGATGAAGG + Intergenic
1132452006 15:101973689-101973711 TCTCTCTTGCTGATGGACAAGGG - Intergenic
1132454889 16:16932-16954 TCTCTCTTGCTGATGGACAAGGG + Exonic
1135355643 16:21766945-21766967 TCTCTGCTCATGCTGGAAGATGG + Intergenic
1135729690 16:24883677-24883699 TCTAACCTAGTGAAGGAAGAGGG - Intronic
1138404051 16:56774286-56774308 TGGCTCCTACTGATAGCAGACGG - Intronic
1139117309 16:63972064-63972086 TCTCTCTGAATGATGGAAGTTGG + Intergenic
1146780066 17:35662043-35662065 TCACTACTATTGATGGAGGAAGG - Intronic
1147931151 17:43982400-43982422 TCTCCTCTACTGATTGAGGAAGG + Intronic
1155153879 18:23142674-23142696 GCTGTCCTACTCATGGGAGATGG + Intronic
1156596920 18:38558111-38558133 TCTCCCATAATGATGGCAGAGGG + Intergenic
1158287536 18:55900997-55901019 TCTCTGTTTCTGATGGAAAAAGG - Intergenic
1158683698 18:59593515-59593537 TCTGTGCTACTGAAGGAGGATGG - Intronic
1165994138 19:39832843-39832865 CCACTCCTCCTGATGGGAGAAGG + Intronic
1167198252 19:48045388-48045410 GGTCTCCTACTGTTGGAAAAGGG + Intergenic
925452654 2:3983094-3983116 TATCTCCTAATGAAGGAAGGTGG - Intergenic
925769079 2:7265021-7265043 TCTCTCTTGCTCATGGAACATGG + Intergenic
927766703 2:25816533-25816555 TCTCTCCTTCTGCTGGAATCTGG - Intronic
931434167 2:62232711-62232733 TCTCTCCAACTTCTGGAGGAGGG - Intergenic
931485555 2:62687291-62687313 TTTTTCCTATTGATGGAAGGAGG + Intronic
932637847 2:73408207-73408229 GCTCTCCTACTAGTGAAAGAAGG - Intronic
936568221 2:113596165-113596187 TCTCTCTTGCTGATGGACAAGGG - Intergenic
937081882 2:119146162-119146184 TCTCCTCTACTGAGGGGAGATGG + Intergenic
937402608 2:121597943-121597965 TCTCACCTGATGAGGGAAGAAGG + Intronic
939515389 2:143160966-143160988 AATCTCCTACTGATAGAACATGG + Intronic
944085877 2:195847770-195847792 TCTCTCCTACTGGTTCAAAATGG - Intronic
945154026 2:206818532-206818554 TATTTCCTACTGCTGGGAGAAGG + Intergenic
946978961 2:225185643-225185665 TCTCCCCTACTGATATAAGCAGG - Intergenic
947596466 2:231415102-231415124 TTTCTCCCACTGGTGGCAGAAGG + Intergenic
948151258 2:235746912-235746934 CCCTTCCTACTGATGGAACATGG - Intronic
1169695005 20:8377396-8377418 GCTTTTCTTCTGATGGAAGAGGG + Intronic
1169760142 20:9082803-9082825 TCTATGCTACTTATGGCAGATGG - Intronic
1171266282 20:23774565-23774587 CATCTCCTACTGATAAAAGAGGG - Intergenic
1171345238 20:24460897-24460919 ACTCTCCTCCTGGTGGAGGATGG - Intergenic
1173795525 20:45857053-45857075 TCTCTCCTAATCGTGGCAGAGGG + Intronic
1183931103 22:41236723-41236745 TCTCTTCTGCTGAGGGAAGATGG - Intronic
1185022798 22:48389871-48389893 TCTCTCCTCATCATGGAAGGAGG + Intergenic
949711714 3:6878230-6878252 GCTGTCCTTCTGATTGAAGATGG + Intronic
951843346 3:27058706-27058728 TCTTGCCTACTAATGGAAGGAGG - Intergenic
953147469 3:40291610-40291632 TATCTCCTACTGATAGCAGCAGG - Intergenic
953855378 3:46495740-46495762 TCTCAACTAGTGAGGGAAGAAGG - Intergenic
955640279 3:61075272-61075294 TCTCTCCTCCTGCAAGAAGAGGG + Intronic
955785472 3:62533360-62533382 TCTCACCTACTGCTTGAACACGG + Intronic
956672104 3:71700750-71700772 TCTCCCCTGCTAAAGGAAGAGGG + Intronic
958977008 3:100679700-100679722 TCTCTCCTACTCAAAGAAGAGGG - Intronic
959217374 3:103468943-103468965 TATCTCCAACTGAAGCAAGAAGG - Intergenic
959607234 3:108255156-108255178 TCTCACCTACTTATTCAAGAAGG - Intergenic
960636669 3:119791468-119791490 TGTCTTCTTCTGATGGAGGAAGG + Intronic
962098363 3:132315705-132315727 TGTTTCCTACTGCCGGAAGAAGG + Intergenic
962903687 3:139782152-139782174 TTTCTCCTACTCATGGAGGGTGG + Intergenic
963298609 3:143574636-143574658 TCTCTCCTGGGGATGGAAGTAGG + Intronic
964448171 3:156782667-156782689 TTACTCCTAGTGAAGGAAGAGGG + Intergenic
964713091 3:159692723-159692745 TCTCTCAGGCTGATGGCAGAGGG + Intronic
965675412 3:171190172-171190194 ATTCTCCCACTGATGGAAGTGGG + Intronic
965771463 3:172186156-172186178 TTTGTTCTACTGATGGAAGAAGG - Intronic
967117743 3:186356936-186356958 CCTCTCCTACTGATGGGAGTTGG - Intronic
967118051 3:186360016-186360038 CCTCTCCTACTGATGGGAGTTGG - Intronic
967532607 3:190566338-190566360 TCCCTCATCCTGAAGGAAGAGGG + Intronic
971370099 4:26012009-26012031 TCTCTCCTTCTGACGGACCATGG + Intergenic
972666823 4:41172782-41172804 TCTTTCCACCTGATGGAAGGGGG + Intronic
974580633 4:63796167-63796189 AGACTCCTACTAATGGAAGAAGG - Intergenic
975836804 4:78431179-78431201 TCTTTGCTACTGATGGTAGATGG + Intronic
977736559 4:100424077-100424099 TCAGTCCTTCTGATTGAAGATGG - Intronic
981873181 4:149510539-149510561 TGTCTCATGATGATGGAAGATGG - Intergenic
984483471 4:180336183-180336205 TCTCTCCTATAGATGTTAGAAGG - Intergenic
985355163 4:189110839-189110861 TTTCTCCTATTGATGGCAGACGG + Intergenic
988836566 5:35038487-35038509 GGTCTCCTGATGATGGAAGAGGG + Intronic
989293999 5:39802709-39802731 TCTCTCCAACTAGAGGAAGAAGG - Intergenic
989996998 5:50847639-50847661 TCTGTCCTCCTCATGGAAGCTGG + Intergenic
990777383 5:59317329-59317351 TCCCTCCCACTGAGTGAAGAAGG - Intronic
991700541 5:69312892-69312914 TCACTGCTACTCATGGAAGCAGG - Intronic
993667179 5:90713806-90713828 TTTCTCCTACTCATGGAGGTGGG - Intronic
996352639 5:122562705-122562727 TCTTTCTTGCTCATGGAAGAAGG + Intergenic
997099647 5:130955156-130955178 TATCTCCTGATGAGGGAAGAGGG - Intergenic
997195565 5:131977022-131977044 CCTCTGCTCCTGAAGGAAGACGG - Intronic
997240979 5:132308113-132308135 TCTGTCCTTCTGCTGGAGGATGG + Intronic
997419120 5:133751971-133751993 TCTCTGCTGCTAATGGAAGCTGG + Intergenic
1000988624 5:167888518-167888540 TCTCTCCTACTGCAGATAGAGGG - Intronic
1001013206 5:168117195-168117217 TCTCACCAACAGATGGAAGAGGG + Intronic
1001483516 5:172104252-172104274 TCACTGCCACTGATGGAAGAGGG - Intronic
1002559767 5:180073111-180073133 TGTCTCCTACTGCGGGAAGTGGG + Intergenic
1002873980 6:1194373-1194395 TCTTATCTATTGATGGAAGATGG - Intergenic
1003220879 6:4160082-4160104 TCATTCCTAATGTTGGAAGAGGG + Intergenic
1003702507 6:8484240-8484262 TTTCACCTAGTAATGGAAGAAGG - Intergenic
1006517147 6:34551409-34551431 TCTCTCCTATGGAGGGAACAGGG - Intronic
1008501355 6:52186218-52186240 TCTCTCCTTCTGAAGGAAAATGG - Intergenic
1011531904 6:88332140-88332162 ACTCTTCTACTCATGGCAGAAGG + Intergenic
1012122842 6:95388588-95388610 TCTCTCCTGCTCTTGGAGGAGGG - Intergenic
1012330825 6:97984200-97984222 TTTATTCTAGTGATGGAAGACGG + Intergenic
1014588982 6:123237945-123237967 TCTTTTCTACTGATAGAATAGGG - Intronic
1014978967 6:127923779-127923801 CCTCTCCTCTTGATGGAAGGTGG - Intergenic
1016545367 6:145216956-145216978 TCTCTCTTACTGATTAAAGATGG - Intergenic
1019299024 7:294221-294243 TCCCTCCCACAGATGGAAGCAGG + Intergenic
1020218850 7:6218406-6218428 TCTCTCCTCCAGATGGAGCACGG + Intronic
1021099120 7:16568752-16568774 TCTCTCCGACTGCTTTAAGATGG - Intronic
1021338020 7:19428085-19428107 CCTCTCTTACTGCTGGAAGCAGG - Intergenic
1021832619 7:24630998-24631020 TCTCTTCTACTCATGGATTAAGG + Intronic
1024348441 7:48337265-48337287 TGTCTTTTACTGATGGAACAGGG - Intronic
1026435088 7:70389481-70389503 TCTCTCATTCTGTTGGAAGGAGG + Intronic
1031133864 7:117864112-117864134 TTGCTGCTACTGATGGAAGCAGG - Intronic
1033030327 7:137820061-137820083 ACTCACCTTCTGGTGGAAGAAGG - Intronic
1033617413 7:143029816-143029838 TGTCTCCTACTGGGGGAAAAGGG - Intergenic
1034044470 7:147913221-147913243 TCTCTCATACTGCTGGCACAAGG + Intronic
1037149012 8:15612836-15612858 TGTCTCTTACTGATACAAGATGG - Intronic
1039492488 8:37958472-37958494 TTTCTACTACTCAAGGAAGATGG + Intergenic
1041462077 8:58122078-58122100 TCTATCCTTCTGCTTGAAGAAGG + Intronic
1043134908 8:76509302-76509324 TCTCTCTAACTGATAGAAAAAGG - Intergenic
1048184398 8:132226361-132226383 TATCCCCTGCTGATGGAAAAAGG + Intronic
1049055258 8:140231387-140231409 TCTCTCTTTTTGCTGGAAGATGG - Intronic
1049147846 8:141014735-141014757 AGTCTCATACTGGTGGAAGAGGG + Intergenic
1049884310 9:17360-17382 TCTCTCTTGCTGATGGACAAGGG + Intergenic
1050335884 9:4589772-4589794 TCTCCCCACCTGATGGAAGCAGG + Intronic
1053623536 9:39844864-39844886 TCGCTCCTACTTCTGGAAGGAGG - Intergenic
1053881333 9:42598364-42598386 TCGCTCCTACTTCTGGAAGGAGG + Intergenic
1054220364 9:62405835-62405857 TCGCTCCTACTTCTGGAAGGAGG + Intergenic
1054230351 9:62503337-62503359 TCGCTCCTACTTCTGGAAGGAGG - Intergenic
1054740385 9:68800487-68800509 TCCTTCTTACTGATGTAAGAAGG + Intronic
1054962083 9:70980192-70980214 TCTCTCCTCCTGGTAGCAGACGG - Intronic
1058333058 9:103789011-103789033 TCACTCTTAATGGTGGAAGATGG + Intergenic
1059391486 9:114002198-114002220 CCTGTCCTACTGATGAAAGTAGG - Intronic
1060968246 9:127723497-127723519 TCTCTGTTACTGCTGGAAGAGGG + Intronic
1061719038 9:132540291-132540313 TCTGTCCTAGAGCTGGAAGATGG - Intronic
1186477997 X:9873640-9873662 TCTCTGTTACAGATTGAAGAGGG + Exonic
1187786551 X:22894457-22894479 TCTCTAATTCTGATGAAAGATGG + Intergenic
1187833384 X:23405827-23405849 ACTCTCCAACAAATGGAAGAAGG + Intergenic
1188182256 X:27070784-27070806 TCTCTCTAACTGAAGCAAGAAGG + Intergenic
1188877599 X:35450013-35450035 TCTCTCCTCCTGGAGGAACATGG + Intergenic
1189009501 X:37032419-37032441 TGACTCCTACTGATGCAATAAGG - Intergenic
1189039072 X:37523305-37523327 TGACTCCTACTGATGCAATAAGG + Intronic
1189608078 X:42701532-42701554 TGACTCCTACTGATGGAGGATGG - Intergenic
1192233441 X:69281350-69281372 TCTCCCCTACTGGGGGCAGAGGG + Intergenic
1195290401 X:103427161-103427183 GCTTTCCTACTGATCCAAGATGG - Intergenic
1195377972 X:104245857-104245879 GGACTCCTACTGATGGAAGTAGG - Intergenic
1197769399 X:130080555-130080577 TCTCTCCATTTTATGGAAGAAGG + Intronic
1198363827 X:135921660-135921682 GCTCTCCAACAAATGGAAGAGGG - Intergenic
1198691491 X:139289641-139289663 TCTCTCCAATTGGTGGAATATGG - Intergenic
1199248681 X:145635232-145635254 CCTTTCTTACTGGTGGAAGATGG + Intergenic
1200401495 X:156022796-156022818 TCTCTCTTGCTGATGGACAAGGG - Intergenic