ID: 1069504901

View in Genome Browser
Species Human (GRCh38)
Location 10:68989035-68989057
Sequence GTGCCGGTGACCACGCCCTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 83}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069504888_1069504901 20 Left 1069504888 10:68988992-68989014 CCTGAGGACGAGGATGAGCGGCC 0: 1
1: 0
2: 2
3: 6
4: 80
Right 1069504901 10:68989035-68989057 GTGCCGGTGACCACGCCCTGGGG 0: 1
1: 0
2: 2
3: 4
4: 83
1069504886_1069504901 26 Left 1069504886 10:68988986-68989008 CCTGCGCCTGAGGACGAGGATGA 0: 1
1: 0
2: 1
3: 8
4: 127
Right 1069504901 10:68989035-68989057 GTGCCGGTGACCACGCCCTGGGG 0: 1
1: 0
2: 2
3: 4
4: 83
1069504893_1069504901 -1 Left 1069504893 10:68989013-68989035 CCTGAGGCCGAGGACGGCCCGGG 0: 1
1: 0
2: 2
3: 14
4: 202
Right 1069504901 10:68989035-68989057 GTGCCGGTGACCACGCCCTGGGG 0: 1
1: 0
2: 2
3: 4
4: 83
1069504896_1069504901 -8 Left 1069504896 10:68989020-68989042 CCGAGGACGGCCCGGGTGCCGGT 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1069504901 10:68989035-68989057 GTGCCGGTGACCACGCCCTGGGG 0: 1
1: 0
2: 2
3: 4
4: 83
1069504885_1069504901 27 Left 1069504885 10:68988985-68989007 CCCTGCGCCTGAGGACGAGGATG 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1069504901 10:68989035-68989057 GTGCCGGTGACCACGCCCTGGGG 0: 1
1: 0
2: 2
3: 4
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069504901 Original CRISPR GTGCCGGTGACCACGCCCTG GGG Exonic
900783163 1:4631090-4631112 CTGCCGGTGTCCTCTCCCTGTGG + Intergenic
902628642 1:17691460-17691482 CTGCCGGTCTCCATGCCCTGGGG + Intronic
904584368 1:31571649-31571671 GTCCTGGTGCCCAAGCCCTGAGG - Intergenic
905975107 1:42168740-42168762 GTGCTGGGGACCAGGGCCTGAGG - Intergenic
906142800 1:43543808-43543830 ATGACGGTGAACACGCCTTGGGG - Intronic
912533073 1:110340229-110340251 GTGCCGGTGACCACCTACAGAGG - Exonic
915536451 1:156538995-156539017 TTGCCTGTCACCACGTCCTGGGG + Exonic
918295993 1:183157937-183157959 GTCCTGGAGACCAAGCCCTGTGG + Intergenic
920500003 1:206480032-206480054 GCGCCGGCTACCAGGCCCTGCGG + Exonic
1064029987 10:11877516-11877538 GTGCCTGTGACCTCGGCCTTGGG + Intergenic
1067297324 10:44982341-44982363 GGGCGTGTGACCAGGCCCTGTGG - Intronic
1069504901 10:68989035-68989057 GTGCCGGTGACCACGCCCTGGGG + Exonic
1076732555 10:132445970-132445992 GGGCTGGTGGCCATGCCCTGAGG - Intronic
1077221030 11:1416438-1416460 GTGCCCGTCACCTCTCCCTGAGG + Intronic
1077351366 11:2094714-2094736 GTGCCTGTGACCAAGCCCTGGGG - Intergenic
1082983416 11:59144927-59144949 GCGCCCGTGACCGCGCCCCGCGG - Exonic
1086940208 11:92789455-92789477 GTGGCAGTGTCCATGCCCTGTGG - Intronic
1087160265 11:94941712-94941734 CTGCCGTTGTCCAGGCCCTGTGG + Intergenic
1090460095 11:126883443-126883465 GTGACGGTGACCATGACCTTTGG - Intronic
1090795879 11:130135382-130135404 GTGCCTGGGACGGCGCCCTGGGG + Intronic
1092238797 12:6825270-6825292 GTGCTGGAGACAAAGCCCTGCGG - Intronic
1097850213 12:64404263-64404285 GCCCCGGTGACCACGCCTTCCGG + Intergenic
1111092147 13:83461932-83461954 GTCCTGGTTACCACTCCCTGGGG - Intergenic
1111950121 13:94703311-94703333 GTCCCGGTGACCCCTCCCTCTGG - Intergenic
1113408380 13:110062580-110062602 GTGCATGTGACCGCGCCCTGTGG - Intergenic
1113488954 13:110677063-110677085 ATGCCAGTGACTTCGCCCTGTGG - Exonic
1114532426 14:23404269-23404291 GTGCCTTTGACCACTCCCAGTGG - Intronic
1123716703 15:23039183-23039205 GTCCCGGGTAACACGCCCTGTGG + Intronic
1129736743 15:77970746-77970768 GGGCCGGGGATCACTCCCTGGGG - Intergenic
1129849332 15:78782887-78782909 GGGCCGGGGATCACTCCCTGGGG + Intronic
1131753084 15:95530419-95530441 GTGTGGGTCACCACGCCCGGCGG + Intergenic
1133022077 16:2971186-2971208 GTGCCAATGACCATGCCCTGGGG + Exonic
1133058320 16:3158536-3158558 GGGCCGGTGACCAGGGGCTGCGG - Intergenic
1134984307 16:18638439-18638461 GAGCCGGGGACCAAGTCCTGTGG - Intergenic
1135295753 16:21278082-21278104 GTGCCGGTGACCAAGCACAGGGG - Exonic
1135665355 16:24331127-24331149 GTGTTGGTGAACATGCCCTGTGG + Intronic
1136454544 16:30372808-30372830 GGGCTGGTGACCAGCCCCTGAGG - Intronic
1140091835 16:71845699-71845721 TCGCCGATGACCACGCCCCGGGG + Intergenic
1141172735 16:81701461-81701483 GCACCAGTGACCACGCACTGAGG - Intronic
1141948891 16:87328135-87328157 CTGGGGGTGAACACGCCCTGAGG + Exonic
1142162028 16:88562610-88562632 GGGCTGGAGACCAAGCCCTGTGG + Intergenic
1146638748 17:34524884-34524906 GTGCCGGTATCCAGTCCCTGAGG + Intergenic
1149470812 17:56913903-56913925 GAGCCGGTCACCACTCCGTGCGG - Exonic
1150347556 17:64415770-64415792 TTCCCGGTGCCCACGGCCTGCGG + Intergenic
1151724992 17:75878475-75878497 GAGCCGGTGACGCTGCCCTGCGG - Exonic
1159765877 18:72487603-72487625 GTGCCCGCCACCACGCCCGGTGG - Intergenic
1160488660 18:79318337-79318359 GTGCTGTTGACCACATCCTGTGG - Intronic
1161733714 19:5977879-5977901 GGGCCGGTGAGCCCGGCCTGAGG + Intronic
1161801408 19:6418466-6418488 GTGCAGGTGAGCACGCCCTGGGG - Exonic
1161834149 19:6633714-6633736 GTGCCCGCCACCACACCCTGTGG - Intergenic
1163323559 19:16588640-16588662 GTGCTGGAGACCACGCCCCCAGG + Intronic
1165886672 19:39084018-39084040 GGGCCGGTGTCCGTGCCCTGGGG + Intronic
1166369218 19:42292104-42292126 GTGCCTGTGAGCACACCCAGCGG + Exonic
1166606889 19:44151346-44151368 GTGCCTGTAACCACGTCCGGCGG + Intronic
937952625 2:127400655-127400677 GTACCTGTGACCACGCCCCACGG + Intergenic
946465905 2:219911989-219912011 GGGCTGGTGACCACGACCTTGGG - Intergenic
948364459 2:237445811-237445833 ATGCCAGTGTCCCCGCCCTGGGG - Intergenic
949065447 2:241987574-241987596 GTTCCGGGGACCACACCCAGCGG - Intergenic
1171484930 20:25479620-25479642 CTGCCTGTGGCCATGCCCTGGGG - Intronic
950572779 3:13812259-13812281 GTGCCTGTGACCACGTCGAGGGG + Intergenic
952847381 3:37699808-37699830 GAGCCAGTGTCAACGCCCTGAGG - Intronic
956892305 3:73624725-73624747 GACCCGCTGACCACGCCGTGCGG - Exonic
961508169 3:127385311-127385333 GTGCCGATCACCACCACCTGAGG - Intergenic
963390323 3:144654741-144654763 GTGCCCGCCACCACGCCCGGAGG - Intergenic
968510627 4:993988-994010 GTGAGGGTGACCAGGCGCTGTGG - Intronic
975261952 4:72313373-72313395 GTGCCCATGCCCACGCCCTTAGG + Intronic
975714148 4:77189466-77189488 GAGCCAGTAACCACTCCCTGTGG - Intronic
988586474 5:32511777-32511799 GTGCTGGTGGCCTCGCCCTCTGG - Intergenic
989782240 5:45281731-45281753 GTGCCCGCCACCACGCCCGGGGG + Intronic
997240447 5:132302656-132302678 GTGCCAGTCACCAAGCACTGAGG - Intronic
1007701210 6:43767663-43767685 ATGCCGGTGACAACACACTGGGG + Intergenic
1012788943 6:103667502-103667524 GGGCCTGTGACAAAGCCCTGAGG - Intergenic
1016658115 6:146543885-146543907 GAGCCGGGGACCCCGGCCTGGGG + Exonic
1017720608 6:157240894-157240916 GGGCCGATGACCCAGCCCTGGGG + Intergenic
1019100459 6:169625556-169625578 GTGCCGGGGACCAGGCCCGACGG + Intronic
1027140120 7:75650819-75650841 GAGCTGGTGTCCCCGCCCTGGGG + Intronic
1028505499 7:91566046-91566068 GTGGCGGTGACTATGCCCAGCGG - Intergenic
1029419285 7:100464112-100464134 GGGCCGGTGACCACCTCTTGAGG + Exonic
1034343100 7:150370295-150370317 GAGCCGGTGATCAGGCCCCGAGG + Intronic
1036910661 8:12755005-12755027 GAGCCGGTGACCGTGCCCTGTGG - Exonic
1050094232 9:2047270-2047292 CTGCCGGTGCCCGCGCCCGGCGG + Exonic
1057081582 9:92177919-92177941 GTGCCCATGCCCAGGCCCTGTGG + Intergenic
1057800836 9:98190922-98190944 GTGCCTATGACCTTGCCCTGCGG - Intronic
1059112336 9:111569256-111569278 GTCCCAGTGACCATGACCTGGGG + Intronic
1059692072 9:116695068-116695090 GTTCCCTTGACCACGCTCTGGGG - Intronic
1062611835 9:137378950-137378972 GTGACGGTGACCATTGCCTGGGG + Intronic
1062611873 9:137379084-137379106 GTGACGGTGACCATTGCCTGTGG + Intronic
1195976179 X:110530070-110530092 GTGCGTGTGCCCACGCCCAGTGG + Intergenic
1196091426 X:111747763-111747785 GTGTCAGCCACCACGCCCTGTGG + Intronic
1198275497 X:135094907-135094929 GAGCCGGTGACCTCACCATGGGG + Intergenic