ID: 1069510368

View in Genome Browser
Species Human (GRCh38)
Location 10:69037658-69037680
Sequence CAGAGCCCGGAGATGCAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069510360_1069510368 27 Left 1069510360 10:69037608-69037630 CCCCAGGTGAGGAAAGAACCTGC No data
Right 1069510368 10:69037658-69037680 CAGAGCCCGGAGATGCAGGCAGG No data
1069510363_1069510368 9 Left 1069510363 10:69037626-69037648 CCTGCCTGAGAGCAAAGACAACA No data
Right 1069510368 10:69037658-69037680 CAGAGCCCGGAGATGCAGGCAGG No data
1069510364_1069510368 5 Left 1069510364 10:69037630-69037652 CCTGAGAGCAAAGACAACATGAG No data
Right 1069510368 10:69037658-69037680 CAGAGCCCGGAGATGCAGGCAGG No data
1069510361_1069510368 26 Left 1069510361 10:69037609-69037631 CCCAGGTGAGGAAAGAACCTGCC No data
Right 1069510368 10:69037658-69037680 CAGAGCCCGGAGATGCAGGCAGG No data
1069510362_1069510368 25 Left 1069510362 10:69037610-69037632 CCAGGTGAGGAAAGAACCTGCCT No data
Right 1069510368 10:69037658-69037680 CAGAGCCCGGAGATGCAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069510368 Original CRISPR CAGAGCCCGGAGATGCAGGC AGG Intergenic
No off target data available for this crispr