ID: 1069510879

View in Genome Browser
Species Human (GRCh38)
Location 10:69041671-69041693
Sequence AGTGCACTGGGCCACGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069510879_1069510888 12 Left 1069510879 10:69041671-69041693 CCCTCCCCGTGGCCCAGTGCACT No data
Right 1069510888 10:69041706-69041728 ACGCATGAAGCCCACTGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069510879 Original CRISPR AGTGCACTGGGCCACGGGGA GGG (reversed) Intergenic
No off target data available for this crispr