ID: 1069512473

View in Genome Browser
Species Human (GRCh38)
Location 10:69052654-69052676
Sequence GCATGCTGTAGAATTTCCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069512463_1069512473 13 Left 1069512463 10:69052618-69052640 CCCAGCTGCCTTTGTACCTTGCT No data
Right 1069512473 10:69052654-69052676 GCATGCTGTAGAATTTCCTTAGG No data
1069512468_1069512473 -10 Left 1069512468 10:69052641-69052663 CCTTTCCCCCACGGCATGCTGTA No data
Right 1069512473 10:69052654-69052676 GCATGCTGTAGAATTTCCTTAGG No data
1069512467_1069512473 -3 Left 1069512467 10:69052634-69052656 CCTTGCTCCTTTCCCCCACGGCA No data
Right 1069512473 10:69052654-69052676 GCATGCTGTAGAATTTCCTTAGG No data
1069512465_1069512473 5 Left 1069512465 10:69052626-69052648 CCTTTGTACCTTGCTCCTTTCCC No data
Right 1069512473 10:69052654-69052676 GCATGCTGTAGAATTTCCTTAGG No data
1069512462_1069512473 18 Left 1069512462 10:69052613-69052635 CCTCTCCCAGCTGCCTTTGTACC No data
Right 1069512473 10:69052654-69052676 GCATGCTGTAGAATTTCCTTAGG No data
1069512464_1069512473 12 Left 1069512464 10:69052619-69052641 CCAGCTGCCTTTGTACCTTGCTC No data
Right 1069512473 10:69052654-69052676 GCATGCTGTAGAATTTCCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069512473 Original CRISPR GCATGCTGTAGAATTTCCTT AGG Intergenic
No off target data available for this crispr