ID: 1069516888

View in Genome Browser
Species Human (GRCh38)
Location 10:69084902-69084924
Sequence AATTATCTGGACATGATGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069516888_1069516892 2 Left 1069516888 10:69084902-69084924 CCCGCCATCATGTCCAGATAATT No data
Right 1069516892 10:69084927-69084949 TTTGTATTTTTAGTAGAGACAGG 0: 164005
1: 210050
2: 126715
3: 67031
4: 60843
1069516888_1069516894 22 Left 1069516888 10:69084902-69084924 CCCGCCATCATGTCCAGATAATT No data
Right 1069516894 10:69084947-69084969 AGGGTTTCACCATGTTATCCAGG 0: 70
1: 6690
2: 68637
3: 189888
4: 209931
1069516888_1069516893 3 Left 1069516888 10:69084902-69084924 CCCGCCATCATGTCCAGATAATT No data
Right 1069516893 10:69084928-69084950 TTGTATTTTTAGTAGAGACAGGG 0: 62759
1: 158911
2: 184886
3: 115845
4: 74212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069516888 Original CRISPR AATTATCTGGACATGATGGC GGG (reversed) Intergenic
No off target data available for this crispr