ID: 1069519720

View in Genome Browser
Species Human (GRCh38)
Location 10:69109168-69109190
Sequence GTTCTGAGCATACTTAAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069519717_1069519720 1 Left 1069519717 10:69109144-69109166 CCCCAACTGTAAGCTAATGTAAG No data
Right 1069519720 10:69109168-69109190 GTTCTGAGCATACTTAAAGTAGG No data
1069519719_1069519720 -1 Left 1069519719 10:69109146-69109168 CCAACTGTAAGCTAATGTAAGTG No data
Right 1069519720 10:69109168-69109190 GTTCTGAGCATACTTAAAGTAGG No data
1069519718_1069519720 0 Left 1069519718 10:69109145-69109167 CCCAACTGTAAGCTAATGTAAGT No data
Right 1069519720 10:69109168-69109190 GTTCTGAGCATACTTAAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069519720 Original CRISPR GTTCTGAGCATACTTAAAGT AGG Intergenic
No off target data available for this crispr