ID: 1069519897

View in Genome Browser
Species Human (GRCh38)
Location 10:69110591-69110613
Sequence CACCCAATGCTCCTGCTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069519897_1069519904 27 Left 1069519897 10:69110591-69110613 CCAGTGAGCAGGAGCATTGGGTG No data
Right 1069519904 10:69110641-69110663 AGAGAGAAGTAGCCTGAGGTTGG No data
1069519897_1069519903 23 Left 1069519897 10:69110591-69110613 CCAGTGAGCAGGAGCATTGGGTG No data
Right 1069519903 10:69110637-69110659 GTAGAGAGAGAAGTAGCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069519897 Original CRISPR CACCCAATGCTCCTGCTCAC TGG (reversed) Intergenic
No off target data available for this crispr