ID: 1069519903

View in Genome Browser
Species Human (GRCh38)
Location 10:69110637-69110659
Sequence GTAGAGAGAGAAGTAGCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069519893_1069519903 27 Left 1069519893 10:69110587-69110609 CCTCCCAGTGAGCAGGAGCATTG No data
Right 1069519903 10:69110637-69110659 GTAGAGAGAGAAGTAGCCTGAGG No data
1069519897_1069519903 23 Left 1069519897 10:69110591-69110613 CCAGTGAGCAGGAGCATTGGGTG No data
Right 1069519903 10:69110637-69110659 GTAGAGAGAGAAGTAGCCTGAGG No data
1069519901_1069519903 -10 Left 1069519901 10:69110624-69110646 CCATCCACTCTGTGTAGAGAGAG No data
Right 1069519903 10:69110637-69110659 GTAGAGAGAGAAGTAGCCTGAGG No data
1069519900_1069519903 -5 Left 1069519900 10:69110619-69110641 CCTGGCCATCCACTCTGTGTAGA No data
Right 1069519903 10:69110637-69110659 GTAGAGAGAGAAGTAGCCTGAGG No data
1069519896_1069519903 24 Left 1069519896 10:69110590-69110612 CCCAGTGAGCAGGAGCATTGGGT No data
Right 1069519903 10:69110637-69110659 GTAGAGAGAGAAGTAGCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069519903 Original CRISPR GTAGAGAGAGAAGTAGCCTG AGG Intergenic
No off target data available for this crispr