ID: 1069521471

View in Genome Browser
Species Human (GRCh38)
Location 10:69124565-69124587
Sequence CTCGGACCCCGCCTCTGCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069521458_1069521471 17 Left 1069521458 10:69124525-69124547 CCCGCGTTCTTCGACTGCTTGTT 0: 1
1: 0
2: 0
3: 4
4: 69
Right 1069521471 10:69124565-69124587 CTCGGACCCCGCCTCTGCGGGGG No data
1069521457_1069521471 23 Left 1069521457 10:69124519-69124541 CCTCTGCCCGCGTTCTTCGACTG 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1069521471 10:69124565-69124587 CTCGGACCCCGCCTCTGCGGGGG No data
1069521459_1069521471 16 Left 1069521459 10:69124526-69124548 CCGCGTTCTTCGACTGCTTGTTG 0: 1
1: 0
2: 0
3: 1
4: 54
Right 1069521471 10:69124565-69124587 CTCGGACCCCGCCTCTGCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069521471 Original CRISPR CTCGGACCCCGCCTCTGCGG GGG Intronic
No off target data available for this crispr