ID: 1069523908

View in Genome Browser
Species Human (GRCh38)
Location 10:69150484-69150506
Sequence AGAATGGTGTGAAACCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1992
Summary {0: 2, 1: 33, 2: 411, 3: 559, 4: 987}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069523908_1069523917 12 Left 1069523908 10:69150484-69150506 CCTCCTGGGTTTCACACCATTCT 0: 2
1: 33
2: 411
3: 559
4: 987
Right 1069523917 10:69150519-69150541 TCCTGAGTAGCTGGGACTACAGG 0: 40895
1: 157395
2: 217955
3: 208005
4: 130380
1069523908_1069523915 4 Left 1069523908 10:69150484-69150506 CCTCCTGGGTTTCACACCATTCT 0: 2
1: 33
2: 411
3: 559
4: 987
Right 1069523915 10:69150511-69150533 CCTCGGCCTCCTGAGTAGCTGGG 0: 1523
1: 101544
2: 207650
3: 241638
4: 162906
1069523908_1069523913 3 Left 1069523908 10:69150484-69150506 CCTCCTGGGTTTCACACCATTCT 0: 2
1: 33
2: 411
3: 559
4: 987
Right 1069523913 10:69150510-69150532 GCCTCGGCCTCCTGAGTAGCTGG 0: 1367
1: 88932
2: 195375
3: 232005
4: 164282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069523908 Original CRISPR AGAATGGTGTGAAACCCAGG AGG (reversed) Intronic
900168912 1:1256795-1256817 AGAATGGCGTGAACCCCGGGGGG + Intronic
900272528 1:1799007-1799029 AGAATGGCGTGAACCCCGGGGGG - Intronic
901385590 1:8906681-8906703 AGAAAGGCGTGAACCCCGGGAGG - Intergenic
901398453 1:8999693-8999715 AGCAGGGTGTGTGACCCAGGAGG + Intergenic
901488565 1:9583126-9583148 AGAATCACTTGAAACCCAGGGGG + Exonic
901847590 1:11993644-11993666 AGAATGGTGTGAACCCCAGGGGG + Intronic
901987703 1:13089346-13089368 AGAATGGTGCGACCCCCAGGAGG - Intergenic
901994109 1:13137421-13137443 AGAATGGTGCGACCCCCAGGAGG + Intergenic
902035082 1:13452182-13452204 AGAATGGTGTGAACCTTGGGAGG - Intergenic
902225760 1:14995532-14995554 AGAATCGTTTGAAACCCTGGAGG + Intronic
902347931 1:15832676-15832698 AGAATGGCATGAACCCCGGGAGG - Intergenic
902454972 1:16526837-16526859 AGAATGGTGTGAACCCAGGAGGG - Intergenic
902497112 1:16880511-16880533 AGAATTGCTTGAACCCCAGGGGG - Intronic
902572937 1:17358476-17358498 AGAATGGCGTGAACTCCAGGGGG + Intronic
902576183 1:17379200-17379222 AGAATGGCGTGAACCCCAGGGGG - Intronic
902655481 1:17865093-17865115 AGAATAGTGTGAAAAGCAAGTGG - Intergenic
902815459 1:18913918-18913940 AGAATGGCGTGAACCCCAGGGGG - Intronic
903123057 1:21228928-21228950 AGAATGGCGTGAACCCCGGGGGG - Intronic
903134613 1:21301403-21301425 AGAATGGCGTGAACCCCAGGGGG + Intronic
903149237 1:21393970-21393992 AGAATCGCTTGAATCCCAGGAGG - Intergenic
903239925 1:21975958-21975980 AGAATGGCGTGAACCCCAGGGGG - Intergenic
903352243 1:22724663-22724685 ACAATAGGGTTAAACCCAGGAGG - Intronic
903422968 1:23231823-23231845 AGAATGGCGTGAACCCCAGGGGG + Intergenic
903714176 1:25351073-25351095 AGAATGGCGTAAAACCTGGGAGG + Intronic
903834645 1:26195588-26195610 AGAATGGTGTGAACCCGGGGAGG - Intronic
903901452 1:26648952-26648974 AGAATGGCGTGAACCCCGGGGGG + Intergenic
903940326 1:26925449-26925471 AGAATGGCGTGAACCCCGGGGGG + Intronic
904185906 1:28704693-28704715 AGAATTGCTTAAAACCCAGGAGG - Intronic
904514581 1:31044310-31044332 AGAATGGCGGGAACCCCAGGGGG + Intronic
904641148 1:31930247-31930269 AGAATGGCGTGAACCCCGGGGGG + Intronic
904713968 1:32452766-32452788 AGAATGGCGTGAATCCCAGGGGG + Intergenic
904740294 1:32669799-32669821 AGAATGGCATGAAACCCGGGAGG + Intronic
904746371 1:32713734-32713756 AGAACGGCGTAAAACCCGGGAGG - Intergenic
904925292 1:34042875-34042897 AGAATGGTGTGAAACCCCGGAGG - Intronic
904984629 1:34534793-34534815 AGAAGGGTGTGAATTCCAGGAGG - Intergenic
905050806 1:35049421-35049443 AGAATAGCGTGAAACCCGGGAGG - Intergenic
905089023 1:35411970-35411992 AGAATGGCGTTGAACCCAGGAGG - Intronic
905147985 1:35903093-35903115 AGAATGGCGTGAAACCCGGGAGG - Intronic
905379200 1:37548061-37548083 AGAATGGCGTGAACCCCGGGAGG + Intronic
905561585 1:38931430-38931452 AGAATGGTGTGAACCCAGGAAGG + Intronic
905583825 1:39102085-39102107 AGAATGGCGTGAACCCCGGGGGG + Intronic
905818368 1:40969805-40969827 AGAATGGCGTGAACCCCAGGAGG - Intergenic
905992543 1:42351680-42351702 AGAATCACTTGAAACCCAGGAGG - Intergenic
906042481 1:42798830-42798852 AGAATGGCGTGAATCCCGGGGGG - Intergenic
906050160 1:42864238-42864260 AGAATGGTGTGAACCCCGGGGGG + Intergenic
906468005 1:46102072-46102094 AGAATGGCGTGAACCCCAGGGGG - Intronic
906478722 1:46186749-46186771 AGAATGGCGTGAACCCCAGGGGG - Intergenic
906500313 1:46337169-46337191 AGAATGGCGTGAACCCCCGGGGG + Intergenic
906541342 1:46588716-46588738 AGAATGGCGTAAACCCCGGGGGG + Intronic
906736318 1:48132647-48132669 AGAATGGCGTGAACCCCGTGGGG - Intergenic
906874849 1:49526001-49526023 AGAATGGCGTGAACCCTGGGAGG + Intronic
907137698 1:52155321-52155343 AGAATGGCATGAACCCCGGGGGG - Intronic
907173701 1:52498330-52498352 AGAATGGCGTGAACCCCGGGGGG - Intronic
907781302 1:57569167-57569189 AGAATGGCGTGAACCCCAGGGGG + Intronic
907963832 1:59309889-59309911 AGAATTGCTTGAAACCCAAGAGG + Intronic
907983255 1:59505614-59505636 ATAATGAGATGAAACCCAGGAGG - Intronic
908413444 1:63889294-63889316 ACAAGGATGTGAAAGCCAGGAGG + Intronic
908726845 1:67185529-67185551 AGAATTGCTTGAAACCCAGGAGG - Intronic
908995648 1:70150008-70150030 AGAATCGCTTGAACCCCAGGAGG - Intronic
909011419 1:70339405-70339427 AGAATTGCTTGAAACCCGGGAGG - Intronic
909050514 1:70762136-70762158 AGAATGGCGTGAACCCTAGGGGG + Intergenic
909322678 1:74309277-74309299 AGAATGGCGTGAACCCCAGGGGG + Intronic
909484763 1:76160378-76160400 AGAATCATTTGAAAGCCAGGAGG + Intronic
909569172 1:77088512-77088534 AGAATGGCGTGAACCTCCGGGGG - Intergenic
909786839 1:79623872-79623894 AGAATGGCATGAACCCCAGAGGG - Intergenic
910453549 1:87371965-87371987 AGAATGGCGTGAACCCCGGGGGG - Intergenic
910822317 1:91364720-91364742 AGAATGGCGTGAACCCCGGGGGG - Intronic
910973270 1:92878729-92878751 AGAATAGCGTGAACCCCGGGGGG + Intronic
910989278 1:93038044-93038066 AGAATCGCCTGAACCCCAGGCGG - Intergenic
911148694 1:94576443-94576465 AGAGTGGAGTGAACCCCAGGGGG - Intergenic
911183109 1:94878143-94878165 AGAATGGCGTGAACCCCAGGGGG + Intronic
911698483 1:100923103-100923125 AGAATGGCGTGAACCCCAGGGGG - Intronic
911807394 1:102228834-102228856 AGAATGGCGTGAACCCCGGGGGG + Intergenic
911825517 1:102480159-102480181 AGAATGGCGTGAACCCCAGGGGG + Intergenic
911831818 1:102559497-102559519 AGAGTTCAGTGAAACCCAGGAGG - Intergenic
912280391 1:108306843-108306865 AGAATGGTGTGAACCCGGGAGGG + Intergenic
912287835 1:108387514-108387536 AGAATGGTGTGAACCCGGGAGGG - Intronic
912356073 1:109055206-109055228 AGAATGGCGTGAACCCCAGGGGG - Intergenic
912366901 1:109141348-109141370 AGAATGGTGTGAACCTCGAGAGG - Intronic
912399298 1:109375452-109375474 AGAATGGCGTGAACCCCAGGGGG + Intronic
912427966 1:109611263-109611285 AGAATTGCTTAAAACCCAGGAGG - Exonic
912619091 1:111137162-111137184 AGAATGGTGTGAACCCCGGGGGG + Intronic
912910299 1:113752487-113752509 AGAATGGCGTGAACCCGGGGAGG - Intronic
912962261 1:114206827-114206849 AGAAAGGTGTGAATTCCAGGAGG + Intergenic
912998131 1:114552149-114552171 AGAATCGCTTGAAACCCAGGAGG + Intergenic
913002074 1:114590687-114590709 AGAATGGTGTGAACCCCGGAGGG + Intronic
913579208 1:120209505-120209527 ACAATGGCGTGAACCCCAGGGGG - Intergenic
913598612 1:120402245-120402267 AGAATGGCGTGAACCCCAGGGGG + Intergenic
913628965 1:120688882-120688904 ACAATGGCGTGAACCCCAGGGGG + Intergenic
913667070 1:121058208-121058230 AGAATGGCGTGAACCCCAGGGGG + Intergenic
913674896 1:121131330-121131352 AGAATTCTTTGAAACCTAGGAGG + Intergenic
913965564 1:143374489-143374511 AGAATAGTGTGACCCCCGGGAGG - Intergenic
913999996 1:143685811-143685833 AGAATGGCGTGAACCCCGGGGGG - Intergenic
914026737 1:143918962-143918984 AGAATTCTTTGAAACCTAGGAGG + Intergenic
914059938 1:144200091-144200113 AGAATAGTGTGACCCCCGGGAGG - Intergenic
914119212 1:144766278-144766300 AGAATAGTGTGACCCCCGGGAGG + Intergenic
914249194 1:145907857-145907879 AGAATGGCGTGAACCCAGGGGGG - Intronic
914288693 1:146252276-146252298 AGAATGGCGTGAACCCCAGGGGG + Intergenic
914306945 1:146428468-146428490 AGAATGGCGTGAACTCCAGGGGG + Intergenic
914549728 1:148703020-148703042 AGAATGGCGTGAACCCCAGGGGG + Intergenic
914561138 1:148820938-148820960 ACAATGGCGTGAACCCCAGGGGG - Intronic
914611696 1:149309270-149309292 ACAATGGCGTGAACCCCAGGGGG + Intergenic
914665120 1:149826397-149826419 AGAATTCTTTGAAACCTAGGAGG + Intergenic
914670645 1:149867424-149867446 AGAATTCTTTGAAACCTAGGAGG - Intronic
914696982 1:150092929-150092951 AGAATGGCGTAAAACCCGGGAGG - Intronic
914734303 1:150401085-150401107 AGAATGGTGTGAACCCGGGAAGG + Intronic
914745001 1:150495088-150495110 AGAATGGCGTGAACCCTGGGGGG + Intronic
914762784 1:150612504-150612526 AGAATGGCATGAACCCCGGGAGG - Intronic
914854313 1:151339486-151339508 AGAATGGCGTAAAACCCAGGAGG + Intergenic
914862081 1:151395086-151395108 AGAATGGCGTGAACCCCGGGAGG + Intergenic
915158337 1:153897116-153897138 AGAATGGCGTGAACCCCAGGGGG - Intronic
915177084 1:154025015-154025037 AGAATGCCGTGAACCCCGGGGGG - Intronic
915350665 1:155223074-155223096 AGAATCGTTTGAACCCGAGGTGG + Intergenic
915359114 1:155274908-155274930 AGAATGGCGTGAACCCCAGGGGG + Intronic
915436130 1:155907999-155908021 AGAATGGCATGAACCCCGGGGGG + Intronic
915688969 1:157667663-157667685 AGAATGGCGTGAACCCCAGGGGG + Intergenic
915923529 1:159997365-159997387 AGAATGGCGTGAACCCCGGGGGG - Intergenic
916067517 1:161148359-161148381 AGAATGACGTGAACCCCGGGGGG - Intergenic
916071768 1:161174316-161174338 AGAATGGCGTAAAACCCGGGAGG + Intronic
916122206 1:161538423-161538445 AGAATGGCGTGAATCCCGGGGGG + Intergenic
916325132 1:163548432-163548454 AGAATGGCGTGAACCCCAGGGGG - Intergenic
916538689 1:165730245-165730267 AGAATGGCACGAACCCCAGGGGG + Intronic
916538975 1:165733510-165733532 AGAATCATTTGAAACCCGGGAGG + Intronic
916700244 1:167285501-167285523 AGAATGGCGTGAACCCCGGGAGG + Intronic
916767505 1:167875862-167875884 AGAATGGTGTGAACCCGGGAGGG + Intronic
916963424 1:169911554-169911576 AGAATCATTTGAACCCCAGGGGG - Intergenic
917026566 1:170649972-170649994 AGAATGGCGTGAACCCCGGGGGG - Intergenic
917343374 1:174003748-174003770 AGAATGGCGTGAAACCCGCGAGG - Intronic
917492369 1:175508386-175508408 ACAAGGGTGTGAATACCAGGAGG - Intronic
917809197 1:178641381-178641403 AGAATAGCTTGAACCCCAGGAGG + Intergenic
917830664 1:178881537-178881559 AGAATTGCTTGAACCCCAGGCGG - Intronic
917888621 1:179414512-179414534 AGAATGGCGTGAACCCCAGGGGG - Intronic
917939595 1:179905284-179905306 AGAATGGCGTGAACCTGAGGGGG + Intronic
917949425 1:180015321-180015343 AGAATGGCATGAACCCCGGGGGG - Intronic
918134078 1:181654893-181654915 AGAATGGCGTGAACCCCAGGGGG + Intronic
918214006 1:182377128-182377150 AGAATGGTGTCAATTCCTGGAGG + Intergenic
918442918 1:184586370-184586392 AGAATGGCGTGAACCCCAGGGGG - Intronic
918492296 1:185094229-185094251 AGAATCGCTGGAAACCCAGGAGG - Intronic
918602612 1:186381414-186381436 AGAATGGCGTGAACCCCAGGGGG - Intronic
918682355 1:187371109-187371131 AGAATGGCGTGAACCCTGGGGGG + Intergenic
918738324 1:188095292-188095314 AGAATTGCTTGAAACCCAGGAGG + Intergenic
918742911 1:188158953-188158975 AGAAAGAGATGAAACCCAGGTGG - Intergenic
918753869 1:188310168-188310190 AGAATGGCGTGAACCCCAGGGGG + Intergenic
918963899 1:191315844-191315866 AGAATGGCATGAACCCCGGGAGG - Intergenic
918998462 1:191794425-191794447 AGAATGGCGTGAACCCCGGGGGG + Intergenic
919126156 1:193395993-193396015 AGAATGGCGTGAACCCCAGGGGG + Intergenic
919202975 1:194382214-194382236 AGAATGGCGTGAACCCCGGGGGG - Intergenic
919332440 1:196189019-196189041 AGAATGGCGTGAACCCCAGGGGG - Intergenic
919339334 1:196283343-196283365 AGAATGGCGTGAACCCCGGGGGG + Intronic
919624194 1:199895524-199895546 AGAATGGCGTGAACTCGAGGCGG - Intergenic
920118387 1:203637340-203637362 AGAATGGCGTGAACCCCCGGGGG + Intronic
920237791 1:204520186-204520208 AGAATGGCATGAACCCCGGGGGG + Intronic
920272342 1:204775237-204775259 ATAAGGGTCTGAAACCCAAGAGG - Intergenic
920547140 1:206827599-206827621 AGAATGGCATGAACCCCGGGGGG + Intronic
921119717 1:212126170-212126192 AGAATGGCATGAACCCCAGGAGG + Intergenic
921201337 1:212809593-212809615 AGAATGGCGTGAACCCGGGGGGG + Intronic
921221071 1:212974317-212974339 AGAATAGTCTGAAATGCAGGTGG + Intronic
921227910 1:213038689-213038711 AGAATGGCGTGAACCCCAGGGGG - Intergenic
921295985 1:213704296-213704318 AGAATGGCGTGAACCCCAGGGGG + Intergenic
921451257 1:215308480-215308502 AGAATGGTTGGAAAGCCAGTTGG + Intergenic
921974688 1:221189590-221189612 AGAATGGCGTGAACCCCGGGAGG + Intergenic
922108819 1:222537540-222537562 AGAATGGCGTGAACCCCGGGAGG + Intronic
922280335 1:224117254-224117276 AGAATCGCTTGAACCCCAGGAGG - Intronic
922285498 1:224167453-224167475 AGAATGGCGTGAACCCCGAGGGG - Intergenic
922420315 1:225455940-225455962 AGAATGGCGTGAACCCCGGGGGG + Intergenic
922496085 1:226059163-226059185 AGAATTGCTTGAACCCCAGGAGG - Intergenic
922559659 1:226559882-226559904 AGAATGGCGTGAACCCGGGGGGG + Intronic
922625423 1:227036516-227036538 AGAATGGCGTGAACCCCGGGGGG - Intronic
922766829 1:228160356-228160378 AGAGGGGTGTGCAGCCCAGGAGG - Intergenic
923484838 1:234419081-234419103 AGAATGGCGTGAACCCTGGGGGG + Intronic
923760758 1:236841978-236842000 AGAATGGCGTGAACCCCGGGGGG - Intronic
924137591 1:240986669-240986691 AGAATGGCGTGAACCCCAGGGGG - Intronic
924263249 1:242253400-242253422 AGAATGGCGTGAACCCCAGGGGG - Intronic
924400333 1:243673701-243673723 AGAATTGCTTGAAACCCGGGAGG - Intronic
924476467 1:244386086-244386108 AGAATTGTTTGAACCCCAGGAGG + Intronic
924522763 1:244819735-244819757 AGAATGGTGTGAACCCCGGGAGG - Intergenic
924616590 1:245617183-245617205 AGAATCGCGGGGAACCCAGGAGG - Intronic
924625875 1:245696091-245696113 ACAAGGGTGTGAACACCAGGAGG - Intronic
924784013 1:247177994-247178016 AGAAGGGTGTGAAATACATGGGG + Intergenic
1063468225 10:6262363-6262385 AGAATGGCGTGAACCCTGGGGGG + Intergenic
1063506741 10:6606706-6606728 AGAACGGCATGAAACCCAGGAGG - Intergenic
1063750110 10:8934283-8934305 AGAATCGCTTGAACCCCAGGAGG + Intergenic
1063811463 10:9713586-9713608 AGGAGGCAGTGAAACCCAGGTGG - Intergenic
1063830505 10:9947208-9947230 AGAATGGCGTGAACCCGGGGGGG - Intergenic
1063989753 10:11547627-11547649 AGAATGGCGTGAACCCCGGGAGG - Intronic
1064200786 10:13283216-13283238 AGAATGGCGTGAACCCCAGGGGG - Intronic
1064386103 10:14893090-14893112 AGAATGGCGTGAACCCCAGGGGG - Intronic
1064393898 10:14964705-14964727 AGAATCGCTTGAAACCCAGGAGG - Intronic
1064462065 10:15544695-15544717 ACAAGGGTGTGAATACCAGGAGG - Intronic
1065017673 10:21476767-21476789 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1065031635 10:21592543-21592565 AGAATGGCGTGAACCCCGGGGGG - Intronic
1065032564 10:21602816-21602838 AGAATGGTGTGAACCCTGGGAGG - Intronic
1065534511 10:26703990-26704012 AGAATGGCGTGAACCCTGGGGGG + Intronic
1065644911 10:27824049-27824071 AGAATGGCGTGAACCCCAGGGGG + Intronic
1065803375 10:29372688-29372710 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1065877525 10:30010410-30010432 AGAATGGTGTGAACCCAGGAGGG + Intergenic
1065883143 10:30054756-30054778 AGAATGGCGTGAACCCCAGGGGG - Intronic
1066273752 10:33848290-33848312 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1066305557 10:34137032-34137054 ATAAAGGTGTGAACCCCAGAAGG - Intronic
1066421676 10:35269716-35269738 AGAATCGCTTGAACCCCAGGAGG - Intronic
1066535059 10:36382314-36382336 AGCATGGCGTGAACCCCGGGGGG - Intergenic
1066540626 10:36442786-36442808 AGAATGGCATGAACCCCAGGGGG + Intergenic
1067115734 10:43434438-43434460 AGAATGGCGTGAACCCCGCGGGG - Intergenic
1067208402 10:44238962-44238984 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1067541721 10:47159808-47159830 AGAGTGGAATGAACCCCAGGTGG + Intergenic
1067714889 10:48683240-48683262 AGAATGGCGTGAACCCCGGGGGG + Intergenic
1068486669 10:57667578-57667600 AGAATGGCGTGAGCCCCAGGGGG - Intergenic
1068623027 10:59207800-59207822 AGAATGGTGTGACATCTGGGAGG + Intronic
1068692365 10:59930433-59930455 AGAATGGCGTGAACCCCGGGGGG - Intergenic
1068808406 10:61226677-61226699 AGAATGGCGTGAATCCCGGGGGG + Intergenic
1069189108 10:65465345-65465367 AGAATGGCGTGAACCCCGGGGGG + Intergenic
1069493380 10:68880780-68880802 AGAATTGCTTAAAACCCAGGAGG - Intronic
1069523908 10:69150484-69150506 AGAATGGTGTGAAACCCAGGAGG - Intronic
1069692972 10:70365978-70366000 AGAATGGCGTGAACACCGGGAGG + Intronic
1070110691 10:73484357-73484379 AGAATGGCATGAACCCCGGGGGG - Intronic
1070197566 10:74173177-74173199 AGAATGGTGTGAACCCAAGGTGG - Intronic
1070989777 10:80721475-80721497 AGAATGGTGTGAACCCAGGGAGG - Intergenic
1071000346 10:80824397-80824419 AGAATGGTGTGAAACCCGGGGGG - Intergenic
1071040870 10:81308047-81308069 AGAATGGTGTGAACCCCAGGGGG - Intergenic
1071085037 10:81860091-81860113 AGAAGATTGTGAAACCCTGGTGG - Intergenic
1071364973 10:84890152-84890174 AGAATGGCGTGAATTCCCGGGGG + Intergenic
1071530134 10:86383674-86383696 AGAATGGCATGAACCCCAGGAGG + Intergenic
1071815900 10:89232579-89232601 GGAATGGTTTGAAACCAAAGAGG + Intronic
1071857057 10:89636424-89636446 AGAATGGCGTGCACCCCGGGGGG - Intronic
1071924694 10:90392312-90392334 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1072100828 10:92227678-92227700 AGAATGGCGTGAACCCCGGGGGG - Intronic
1072222681 10:93339988-93340010 AGAATGGCGTGAACCCCGGGGGG + Intronic
1072466705 10:95669972-95669994 AGAATGGCGTGAACCCCAGGGGG + Intronic
1072593091 10:96845554-96845576 AGAATGGCATGAACCCCGGGGGG - Intronic
1072658683 10:97348637-97348659 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1072899971 10:99398579-99398601 AGAATTGCTTGAAACCCAAGAGG + Intronic
1072922107 10:99585076-99585098 AGAATGGCTTGAAAACCTGGAGG - Intergenic
1073054497 10:100690517-100690539 AGAATGGCGTGAACCCCGTGGGG - Intergenic
1073156063 10:101347840-101347862 AGAATGGCGTGAACCCCGCGGGG - Intergenic
1073258892 10:102173839-102173861 AGAATGGCGTGAACCCGAGGAGG - Intergenic
1073413281 10:103360097-103360119 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1073435641 10:103514176-103514198 AGAATTGCTTGAACCCCAGGAGG - Intronic
1073641303 10:105255097-105255119 AGAATGGCGTGAACCCGGGGGGG + Intronic
1073663071 10:105498989-105499011 AGAATGGTGTGAAACCCGGGAGG + Intergenic
1074055360 10:109918670-109918692 AGAATGGTGTGAACCCAGGAGGG + Intronic
1074124300 10:110516096-110516118 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1074280884 10:112050464-112050486 AGAATGGCGTAAAACCCGGGAGG - Intergenic
1074316906 10:112369363-112369385 AGAATGTCTTGAACCCCAGGAGG + Intergenic
1074417460 10:113279835-113279857 AGAATGGCGTGAACCCCGGAGGG - Intergenic
1074548421 10:114420243-114420265 ACAATGGCGTTGAACCCAGGAGG + Intergenic
1074740365 10:116480316-116480338 GGAATGGCGTGAACCCCGGGAGG + Intergenic
1074968270 10:118512857-118512879 AGAATGGCGTGAATCCCAGGAGG + Intergenic
1075124602 10:119689667-119689689 AGAATTGCCTGAACCCCAGGGGG - Intergenic
1075386988 10:122062120-122062142 AGAATGGAGTGAACCCAGGGAGG - Intronic
1075411979 10:122235174-122235196 AGAATCGCTTGAAACCCAGGAGG - Intronic
1075431343 10:122384517-122384539 AGAATGGTGTGAACCCCAGGGGG + Intronic
1075755161 10:124805242-124805264 AGAATGGCGTGAACCCCGGGAGG + Intronic
1075770092 10:124927042-124927064 AGGATGGCGTGAACCCCAGGGGG - Intergenic
1075937771 10:126358087-126358109 AGAATGGCATGAACCCCGGGGGG + Intronic
1076147673 10:128137401-128137423 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1076452513 10:130566549-130566571 AGAATGGCGTGAACCCCCGGGGG + Intergenic
1076463473 10:130662176-130662198 AGAATTGCTTGAACCCCAGGTGG - Intergenic
1077005258 11:352026-352048 AGAATGGCATGAACCCCGGGGGG + Intergenic
1077052260 11:572369-572391 AGAATGGCGTGAACCCCCAGGGG - Intergenic
1077084900 11:744751-744773 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1077087012 11:758193-758215 AGAATGGCGTGAACCGCGGGGGG + Intronic
1077439431 11:2561111-2561133 AGAATGGTGTGAACCCCAGGGGG + Intronic
1077587751 11:3466882-3466904 AGAATGGTGTGAACCCCGAGAGG + Intergenic
1077644037 11:3907796-3907818 AGAATGGTAAGAAAGCCAGTGGG - Intronic
1077745618 11:4901246-4901268 AGAATGGCATGAACCCCGGGGGG - Intronic
1078168828 11:8912961-8912983 AGAATGGTGTGAACCCAGGAGGG - Intronic
1078286206 11:9958445-9958467 AGAATGGCGTGAACCCCAGGGGG - Intronic
1079189448 11:18265588-18265610 AGGATTGTGGGAGACCCAGGAGG - Intergenic
1079197833 11:18345877-18345899 AGAATGGCATGAACCCCAGGGGG - Intronic
1079474323 11:20812917-20812939 AGAATGGCGTGAACCCCAGGGGG + Intronic
1079616927 11:22506715-22506737 AGAATGGCGTGAACCCAGGGAGG - Intergenic
1079680419 11:23289854-23289876 AGAATTGTTTGAAACCCAGGAGG - Intergenic
1079764972 11:24380827-24380849 AGAATTGCTTGAACCCCAGGAGG - Intergenic
1079820078 11:25115443-25115465 AGAATGGCGTGAACCCTGGGGGG + Intergenic
1080181735 11:29433811-29433833 AGAATGGCGTGAACCCCGCGGGG + Intergenic
1080360451 11:31507188-31507210 AGAATGGTGTGAACCCAGGAAGG + Intronic
1080367027 11:31586729-31586751 AGAACGGCGTTGAACCCAGGAGG - Intronic
1080396557 11:31895279-31895301 AGAATGGCGTGAACCCCAGGGGG - Intronic
1080438165 11:32265298-32265320 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1080472788 11:32562320-32562342 AGAATGGCGTAAAACCCAGGAGG - Intergenic
1080503276 11:32889729-32889751 AGAATGGCGTAAAACCCAGGAGG + Intergenic
1080524067 11:33095730-33095752 AGAATGGCGTGAACCCCAGGGGG + Intronic
1080621922 11:33993874-33993896 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1080810148 11:35696228-35696250 AGAATGGCATGAACCCGAGGCGG - Intronic
1081131689 11:39389029-39389051 AGAATGGCGTGAACCCCGGGAGG - Intergenic
1081170632 11:39866553-39866575 AGAATGGCGTGAACCCTGGGAGG - Intergenic
1081171609 11:39876364-39876386 AGAACGGCGTGAACCCCGGGGGG + Intergenic
1081238590 11:40677028-40677050 AGAAATATGTGAAACACAGGGGG - Intronic
1081344622 11:41968075-41968097 AGAATGGCGTGAACCCCGGGAGG + Intergenic
1081472028 11:43383439-43383461 AGAATCGCTTGAACCCCAGGAGG - Intronic
1081696995 11:45119539-45119561 AGAATTGCGTGAACCCCAGTGGG + Intronic
1081998544 11:47379238-47379260 AGAAAGGTTTGTAAACCAGGAGG - Intergenic
1082032644 11:47616770-47616792 AGAATCTCTTGAAACCCAGGAGG - Intergenic
1082033647 11:47626133-47626155 AGAATCGCTTGAACCCCAGGAGG - Intronic
1082075483 11:47972893-47972915 AGAATCGCTTGAACCCCAGGAGG - Intergenic
1082295544 11:50437647-50437669 AGAATGGCGTGATTCCCAGGAGG + Intergenic
1082730931 11:56796684-56796706 AGAAATGTGTAAAACCCAGAAGG + Intergenic
1082843802 11:57711440-57711462 AGAATCGTTTGAACCCCGGGAGG - Intronic
1083301757 11:61743274-61743296 AGAATGGCGTGAACCCAGGGCGG + Intronic
1083324912 11:61868270-61868292 AGAATGGCGTGAACCCCGGCGGG + Intergenic
1083402772 11:62435498-62435520 AGAATGGCGGGAACCCCGGGGGG - Intronic
1083450482 11:62741209-62741231 AGAATCGCTTGAAACGCAGGAGG + Intergenic
1083456376 11:62781583-62781605 AGAATGGTGTAAAACCTGGGAGG + Intronic
1083554727 11:63616892-63616914 AGAATGGCGTGAACCCCGGGGGG + Intergenic
1083650261 11:64199415-64199437 AGAATGGCGTTGAACCCGGGAGG + Intronic
1083854452 11:65385882-65385904 AGAATGGTGTGAACCCCAGGGGG - Intergenic
1083957552 11:65993494-65993516 AGAATGGCGTGAACCCCGGGGGG + Intergenic
1083972227 11:66086225-66086247 AGAATGGCGTGAACCCCGGGGGG - Intronic
1084104018 11:66968990-66969012 ACAAGGGTGTGAACACCAGGAGG - Intergenic
1084157798 11:67324213-67324235 AGAATGGCGTGAACCCCGGGGGG - Intronic
1084243455 11:67838550-67838572 AGAATGGCGTGAACCCCAACAGG + Intergenic
1084324354 11:68391055-68391077 AGAATGGCATGAACCCAAGGAGG - Intronic
1084619859 11:70262411-70262433 AGAATGGCGTGAACCCCGGGGGG - Intergenic
1084669907 11:70599516-70599538 AGAATGGCGTGAACCCCAGGGGG + Intronic
1084756875 11:71245553-71245575 AAACTGGTGTGCCACCCAGGAGG + Intronic
1084829230 11:71756023-71756045 AGAATGGCATGAACCCCAGGAGG - Intergenic
1085091957 11:73724573-73724595 AGAATGGCGTGAACCCCGGGAGG - Intronic
1085264503 11:75229270-75229292 AGAATCGCTTGAACCCCAGGAGG + Intergenic
1085325162 11:75601055-75601077 AGCATGGTGGGAACCACAGGCGG + Intronic
1085639474 11:78183722-78183744 AGAATGGCGTGAACCCTGGGAGG - Intronic
1085668962 11:78443235-78443257 AGAATGGCGTGAACCCCGGGAGG + Intronic
1085909472 11:80804452-80804474 AGAATGGTGTGAACCCCGGGGGG - Intergenic
1086112581 11:83216411-83216433 AGAATGGCGTGAACCCCAGGGGG - Intronic
1086371513 11:86159972-86159994 ACAAGGGTGTGAAAACCAGGAGG - Intergenic
1086444003 11:86855074-86855096 AGAATCACTTGAAACCCAGGAGG + Intronic
1086479801 11:87222407-87222429 AGAATGGCGTGAACCCTGGGGGG + Intronic
1086819026 11:91412079-91412101 GGAATGGCGTGAACCCCAGGGGG - Intergenic
1086935263 11:92738730-92738752 AGCATGTTGTGAAATCCAGGTGG - Intronic
1086960371 11:92974689-92974711 AGAATGGCATGAACCCCAGGGGG - Intronic
1086997070 11:93369840-93369862 AGAATGGCGTGAACCCCAGGGGG + Intronic
1087121598 11:94580986-94581008 AGAATTGCTTGAAACCCAGGAGG - Intronic
1087283611 11:96240459-96240481 AGAATGGCGTGAACCCCGGGAGG + Intronic
1087295118 11:96363050-96363072 AGAATGGCGTGAACCCCGGCGGG - Intronic
1087295772 11:96371491-96371513 AGAATGGTGTGAACCCGGGAGGG + Intronic
1087346497 11:96978014-96978036 AGAATGGCGTGAACCCCGGGAGG + Intergenic
1087455009 11:98373502-98373524 AGAATGGCGTGACCCCCGGGAGG + Intergenic
1087681934 11:101228229-101228251 AGAATGGTGAGAACCCTGGGGGG + Intergenic
1087814941 11:102648151-102648173 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1088213845 11:107485668-107485690 AGAATAGCGTGAACCCCAGGGGG + Intergenic
1088261146 11:107945092-107945114 AGAATCGCTTGAACCCCAGGGGG + Intronic
1088409426 11:109517223-109517245 AAAATAGTGTGAAATTCAGGAGG - Intergenic
1088467960 11:110162043-110162065 AGAATTGTTTGAACCCCAGGGGG + Intronic
1088483699 11:110320845-110320867 AGAATCGCTTGAACCCCAGGGGG - Intergenic
1088789991 11:113216236-113216258 AGAATGGCGGGAACCCCAGGGGG - Intronic
1089211857 11:116809557-116809579 AGAATGGCTTGAACCTCAGGAGG - Intergenic
1089432099 11:118433648-118433670 AGAATGGCGTGAACCCCGGGGGG - Exonic
1089483376 11:118825522-118825544 AGAATTGTTTGAGCCCCAGGAGG - Intergenic
1089577732 11:119458689-119458711 AGAATGGCGTGAACCCCGTGGGG + Intergenic
1090032270 11:123217391-123217413 AGAATGGCGTAAAACCCGGGAGG - Intergenic
1090270780 11:125384593-125384615 AGAATGGCGTGAACCCAGGGAGG + Intronic
1090301115 11:125640450-125640472 AGAATGGCGTGAACCCCGGGGGG + Intronic
1090327387 11:125900919-125900941 AGAATGGCGTGAACCCCAGGGGG + Intronic
1090708809 11:129366442-129366464 AGAATGGGATAAAACCAAGGTGG - Intergenic
1090905012 11:131067361-131067383 AGCCTGGTGTGAAAGCCAGAGGG + Intergenic
1091486050 12:889727-889749 ACAATGGCGTAAAACCCAGGAGG + Intronic
1091495779 12:971835-971857 AGAATGGCGTGAACCCCGGGGGG - Intronic
1091497321 12:983804-983826 AGAATGGTATCTAACCCAGTAGG - Intronic
1091513652 12:1155563-1155585 AGAATGGTGTGAACCCAGGGAGG - Intronic
1091876366 12:3936817-3936839 AGAATGGCGTGAACCCTGGGAGG + Intergenic
1091901719 12:4149507-4149529 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1091905688 12:4187100-4187122 AGAATCGCTTGAGACCCAGGAGG + Intergenic
1091983573 12:4887085-4887107 AGAATGGCGTGAACCCCGGGGGG + Intergenic
1092040401 12:5379190-5379212 AGAATGGTGTGAACCCAGGAGGG - Intergenic
1092178694 12:6429440-6429462 AGCATGGTGTGGAACCCGGGAGG - Intergenic
1092338073 12:7651523-7651545 AGAATGGCGTGAACCCCAGGTGG + Intronic
1092340468 12:7671749-7671771 AGAATGGCGTGAACCCCGGGAGG - Intergenic
1092414002 12:8275652-8275674 AGAATGGCGTGAACCCCAGGAGG + Intergenic
1092471029 12:8781250-8781272 AGAATCGCTTGAAACCCAGGAGG + Intronic
1092783261 12:12006749-12006771 AGAATGGCGTGAACCCCCTGGGG - Intergenic
1092795520 12:12107291-12107313 AGAATGGCGTGAACCCCGGGGGG + Intronic
1092805580 12:12219292-12219314 AGAATCGTTTGAACCCCGGGTGG - Intronic
1092820173 12:12346182-12346204 AGAATGGCATGAACCCCAGGCGG + Intronic
1092832405 12:12457578-12457600 AGAATGGCGTGAACCCCGGGGGG + Intronic
1093075384 12:14752792-14752814 AGAATGGCATGAACCCCGGGGGG + Intergenic
1093127552 12:15348696-15348718 AGAATGACGTGAACCCCGGGGGG + Intronic
1093264763 12:16989758-16989780 AGAATGGTGTGAATCCGGGAGGG + Intergenic
1093362571 12:18248482-18248504 AGAATGGTGTGAACCCGGGGCGG + Intronic
1093367750 12:18324129-18324151 AGAATGACGTGAACCCCGGGGGG + Intronic
1093871971 12:24303784-24303806 ACAAAGGTGTGAATGCCAGGAGG + Intergenic
1093906798 12:24702750-24702772 AGAATGGCGTGAACCCCGAGGGG + Intergenic
1094010197 12:25799741-25799763 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1094540759 12:31361641-31361663 AGAATTGCTTAAAACCCAGGAGG + Intergenic
1094649358 12:32360094-32360116 AGAATGGTGTGAACCCAGGAGGG + Intronic
1094720525 12:33058649-33058671 AGAATTGCTTGAAACCCGGGAGG - Intergenic
1094737964 12:33256701-33256723 AGAATGGCGTGAATCCCAGAGGG - Intergenic
1094746152 12:33346357-33346379 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1095172977 12:39056888-39056910 AGAATCGCTTGAACCCCAGGAGG - Intergenic
1095241604 12:39866566-39866588 AGAATGGCGTGAACCCCGGGGGG - Intronic
1095463567 12:42467203-42467225 AGAATTGCTTGAACCCCAGGAGG - Intronic
1095593501 12:43933287-43933309 AGAATGGCGTGAACCCTGGGGGG - Intronic
1095784804 12:46098300-46098322 AGAATGGAGTGAAACCCAGGAGG + Intergenic
1095869073 12:47005799-47005821 AGAATGGTGTGATTTCTAGGAGG + Intergenic
1095915214 12:47471316-47471338 AGAATGGGCTTGAACCCAGGAGG + Intergenic
1095966815 12:47873448-47873470 AGAATGGCGTGAACCCCAGGGGG - Intronic
1096190554 12:49615037-49615059 AGAATGGCGTGAACCCAGGGAGG + Intronic
1096223229 12:49845599-49845621 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1096302786 12:50446515-50446537 AGAATCGCTTGAAACCCAGGAGG - Intronic
1096387599 12:51205126-51205148 AGAATGGCGTGAACCCGGGGGGG - Intronic
1096712751 12:53469635-53469657 AGAATTGCTTGAAACCCGGGAGG + Intronic
1096806181 12:54142552-54142574 AGAATGGCGTGAACCCGGGGAGG + Intergenic
1096935214 12:55266843-55266865 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1097061678 12:56289530-56289552 AGAATGGTGTTGAACCTTGGAGG - Intronic
1097114041 12:56683868-56683890 AGAATGGCGTGAACCCCAGGGGG + Intronic
1097311862 12:58127558-58127580 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1097490832 12:60269239-60269261 AGAATGGCGTGAACCCCGGGAGG - Intergenic
1097987066 12:65794770-65794792 AGAATGGCGTGAACCCTGGGGGG + Intergenic
1097988833 12:65813110-65813132 AGAATGGCGTGAACCCGGGGGGG + Intergenic
1098122452 12:67256370-67256392 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1098401514 12:70081517-70081539 AGAATGGCGTGAACCCATGGAGG - Intergenic
1098602454 12:72347923-72347945 AGAAGGGTGTGAATACCAGTAGG + Intronic
1098619997 12:72584018-72584040 AGAATGGCGTGAACCCCAGGGGG - Intronic
1098719571 12:73879902-73879924 AGAATGATGTGAACCCCGTGGGG + Intergenic
1098750354 12:74285151-74285173 AGAATGAGCTGAAACCCATGAGG + Intergenic
1098804672 12:75008551-75008573 AGAATGGTGTGAACCCCGGGAGG - Intergenic
1098812593 12:75114951-75114973 AGAATGGCGTGAACCCCGGGGGG - Intronic
1098814862 12:75146041-75146063 AGAATGGTGTGAACCCCGGGAGG - Intronic
1098821241 12:75232505-75232527 AGGAGGTTGTGAAACCCAGATGG - Intergenic
1099006857 12:77244187-77244209 AGAATGGCGTGAACCCCGGGGGG + Intergenic
1099350880 12:81567134-81567156 AAAATGGCGTGAATCCCGGGAGG - Intronic
1099360258 12:81691929-81691951 ACAAGGGTGTGAATACCAGGAGG - Intronic
1099716425 12:86299203-86299225 AGAATGAACTGAACCCCAGGAGG - Intronic
1099968907 12:89480687-89480709 AGAATGGCGTGAACCCCAGGGGG - Intronic
1099999839 12:89819956-89819978 AGAATGGCGTAAACCCCGGGGGG + Intergenic
1100173089 12:91999418-91999440 AGAATAGCGTGAACCCCAGGGGG + Intronic
1100251899 12:92834967-92834989 AGAATGGCGTGAACCCCGAGAGG - Intronic
1100293578 12:93239516-93239538 ACAAGGGTGTGAATACCAGGAGG - Intergenic
1100481420 12:94983256-94983278 ACAAGGGTGTGAATACCAGGAGG - Intronic
1100592611 12:96043516-96043538 AGAATGGCGTGAACCCCGGGGGG + Intronic
1100615882 12:96231460-96231482 TGAATGCTGTGAATCCCAGCAGG - Intronic
1100745922 12:97645674-97645696 ACAAGGATGTGAAAACCAGGAGG - Intergenic
1100834656 12:98554487-98554509 AGAATGGCGTGAACCCCGGGAGG + Intergenic
1101143834 12:101822322-101822344 AGAATGGCGTGAACCCCGGGGGG + Intronic
1101146081 12:101841573-101841595 AGAATGGCGTGAACCCCAGGAGG + Intergenic
1101356721 12:103986006-103986028 AGAATGGTGTGAACCCAGGAGGG - Intronic
1101509488 12:105379937-105379959 AGAATGGCGTGAACCCCAGGGGG + Intronic
1102277096 12:111590976-111590998 AGAATGGCATGAAACCCGGGAGG - Intronic
1102354848 12:112224353-112224375 AGAATGGCGTGAACCCCGGGAGG - Intronic
1102546172 12:113657572-113657594 ACAATGTTGTCAAAGCCAGGTGG + Intergenic
1102979295 12:117228868-117228890 AGAATGGCGTGAACCCCGGGAGG - Intronic
1102989169 12:117302503-117302525 AGAATGGCGTGAACCCCAGGGGG + Intronic
1103246863 12:119465222-119465244 AGAATGGCGTGGAACCCGGGAGG + Intronic
1103289371 12:119831778-119831800 AGAATGGCGTGAACCCAGGGGGG + Intronic
1103294487 12:119874795-119874817 AGAATGGCGTGAACCCCGGGGGG + Intronic
1103312772 12:120025137-120025159 AGAATGGTGTGAACCCCAGGGGG - Intronic
1103376439 12:120459765-120459787 AGAATGGCGTGAACCCCAGGGGG + Intronic
1103387556 12:120545268-120545290 AGAACGGCGTGAACCCCAGGAGG - Intronic
1103437774 12:120940355-120940377 AAAATGGTGTGAACCCCGGGAGG - Intergenic
1103488655 12:121299047-121299069 AGAATCGCTTGAAACCCGGGAGG + Intergenic
1103489070 12:121302799-121302821 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1103638917 12:122332508-122332530 AGAATCACTTGAAACCCAGGAGG - Intronic
1103709512 12:122901305-122901327 AGAATGGTGTGAACCCCAGGGGG - Intergenic
1104263954 12:127213011-127213033 AGAATTGCTTGAACCCCAGGAGG - Intergenic
1104279538 12:127362190-127362212 AGCATGTTGGGAAACCTAGGTGG - Intergenic
1105489596 13:20874902-20874924 AGAATTGCTTGAAACCCAGGAGG + Intronic
1105494055 13:20914931-20914953 AGAATGGTGTGAACCCTGGGGGG - Intergenic
1105758960 13:23495420-23495442 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1105885410 13:24637500-24637522 AGAATGGCGTGAACCCCGGGGGG + Intergenic
1105975240 13:25467638-25467660 AGAATGGCGTGAACCCCGGGGGG - Intronic
1106265599 13:28106829-28106851 AGAATTGCTTGAACCCCAGGAGG + Intergenic
1106282792 13:28290590-28290612 AGAATCATTTGAACCCCAGGAGG + Intronic
1106316345 13:28597275-28597297 AGACTGGTCTGAAACTCATGGGG + Intergenic
1106469680 13:30043299-30043321 AGAAGGGTGTGAATGCCAGGAGG - Intergenic
1106705292 13:32273309-32273331 AGAATGGCGTGAACCCCAGGGGG - Intronic
1107053170 13:36074398-36074420 AGAATGGCGTGAACCCTGGGGGG + Intronic
1107069555 13:36255571-36255593 AGAATCGCTTGGAACCCAGGAGG + Intronic
1107261204 13:38493821-38493843 AGAATGGCGTGGAACCTGGGAGG - Intergenic
1107356639 13:39574391-39574413 AGAATGGCGTGAACCCCAAGAGG + Intronic
1107366511 13:39684336-39684358 AGAATGGCGTGAACCCCAGGGGG - Intronic
1107475241 13:40729816-40729838 AGAATCGCATGAAACCCAGAAGG - Intronic
1107509998 13:41074018-41074040 AGAATGGCATGAACCCCAGGGGG - Intronic
1107531848 13:41290184-41290206 AGAATGGCGTAAAACCCGGGAGG - Intergenic
1107563715 13:41581087-41581109 AGAATGGCGTGAACTCCAGGGGG - Intronic
1107780448 13:43896635-43896657 AGAATGGCGTGAACCCCGGGAGG - Intergenic
1107781726 13:43910681-43910703 AGAATGGCGTGAACCCCGAGGGG - Intergenic
1107895302 13:44956052-44956074 AGAATGGTGTGAACCCCAGGGGG + Intronic
1107926078 13:45263315-45263337 AGAATGGTGTGAACCTTGGGAGG - Intronic
1108114800 13:47115546-47115568 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1108136912 13:47374443-47374465 AGAATGGCGTGAACCCCCAGGGG - Intergenic
1108247378 13:48531904-48531926 AGTAAGGTGTAAAACCCAGCAGG + Intronic
1108407408 13:50119237-50119259 AGAATGGCGTGAACCCCAGGGGG - Intronic
1108780816 13:53829904-53829926 AGAATCCCTTGAAACCCAGGAGG - Intergenic
1108831060 13:54478612-54478634 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1109196776 13:59386525-59386547 AGAATTGCTTGAACCCCAGGAGG + Intergenic
1109382164 13:61577040-61577062 AGAATGGCGTGAATCCTGGGGGG + Intergenic
1109463221 13:62691901-62691923 AGAATTGCTTGAACCCCAGGGGG - Intergenic
1109486386 13:63027253-63027275 AGAATGGTGTGAACCCGGGGGGG - Intergenic
1109597219 13:64571584-64571606 AGAATGGCGTGAACCCGGGGAGG - Intergenic
1109822062 13:67669837-67669859 AGAATGGCGTGGACCCCCGGGGG - Intergenic
1109961356 13:69636791-69636813 AGAATGGTGTGAACCCTGGAGGG - Intergenic
1110223289 13:73094930-73094952 AGAATGGCGTGAACCCCGGGGGG - Intergenic
1110612667 13:77506235-77506257 AGAATGGCGTGAACCCTGGGAGG + Intergenic
1110641610 13:77831029-77831051 AGAATTGTGTGAACCCGGGGAGG - Intergenic
1110709463 13:78633976-78633998 AGAATGGCGTAAACCCCGGGGGG + Intronic
1110749899 13:79101088-79101110 AGAATGGCATGAACCCCCGGAGG - Intergenic
1110900235 13:80813236-80813258 AGAATGGCGTGAGTCCCGGGAGG - Intergenic
1110976770 13:81847469-81847491 AGAATGGCGTGAACCCCCGGGGG - Intergenic
1111140609 13:84113500-84113522 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1111175461 13:84589610-84589632 AGAATGGCGTGAACCCGGGGAGG + Intergenic
1111580285 13:90213898-90213920 AGAATGGCGTGAACCCCGGGAGG - Intergenic
1111734416 13:92119486-92119508 AGAATGGTGTGAACCCCGGGGGG - Intronic
1111828150 13:93295021-93295043 AGAATGTTGGGAAGCCTAGGTGG + Intronic
1111840850 13:93449344-93449366 ATTAAGGTGTGAAACGCAGGTGG + Intronic
1111845800 13:93506967-93506989 AGAATGGTGTGAACCCGGGAGGG + Intronic
1112091038 13:96084438-96084460 AGAATGGCGTGAACCCCCGGGGG - Intergenic
1112274307 13:98002101-98002123 AGAATGGTGTGAACCCGGGGGGG - Intronic
1112302842 13:98246182-98246204 AGAATGGCGTGAACCCCAGGGGG - Intronic
1112427721 13:99318730-99318752 AGAATGGCGTGGAACCCGAGAGG + Intronic
1112685519 13:101821035-101821057 AGAATGGCGTGAATCCCGGGGGG - Intronic
1113145339 13:107201486-107201508 AGAATGGTGTGAACCCGCGAGGG + Intronic
1113327900 13:109300350-109300372 AGAATGGCGTGAACCCGGGGAGG + Intergenic
1113637576 13:111930334-111930356 AAAATGGTGTGAACCCGGGGGGG - Intergenic
1113794332 13:113048528-113048550 AGAATGGCGTGAACCCGGGGAGG - Intronic
1113916717 13:113878285-113878307 AGAATGGCGTGAAACCTGGGAGG - Intergenic
1114294892 14:21320377-21320399 AGAACGGCGTGAACCCCAGGGGG - Intronic
1114420687 14:22580168-22580190 AGCATGTTGTGAAACCAAGGTGG + Intronic
1114520639 14:23332681-23332703 AGAATGGCGTGAACCCTGGGGGG - Intergenic
1114855175 14:26430435-26430457 AGAATGGCGTGAACCCTGGGGGG - Intergenic
1115201483 14:30858785-30858807 AGAATGGCGTGAACCCCGGGGGG + Intergenic
1115219027 14:31040984-31041006 AGAATGGTGTGAACCCAGGGAGG + Intronic
1115251738 14:31355643-31355665 AGAATCACTTGAAACCCAGGAGG + Intronic
1115271965 14:31562691-31562713 AGAATGGCGTGAACCCCGGGAGG - Intronic
1115403404 14:32989553-32989575 AGAATGGCGTGAACCCCAGGGGG + Intronic
1115431611 14:33325555-33325577 AGAATCACTTGAAACCCAGGAGG + Intronic
1115627051 14:35203773-35203795 TGAATGGCATGAACCCCAGGGGG + Intronic
1115693710 14:35874124-35874146 AGAATGGCGTGAACCCCAGGAGG + Intronic
1115806397 14:37056399-37056421 AGAATGGCGTGAACCCCGGGGGG + Intronic
1115898276 14:38115515-38115537 AGAATGGCCAGAAACCCGGGAGG + Intergenic
1115995833 14:39194642-39194664 AGAATGGCGTGAACCCCGGGGGG + Intergenic
1116067334 14:40001111-40001133 AGAATGGCGTGAACCCCGGGGGG + Intergenic
1116094960 14:40355836-40355858 AGAATGGTGAGAACAGCAGGAGG + Intergenic
1116261905 14:42640751-42640773 AGAATGGCGTGAACCCGGGGAGG - Intergenic
1116315716 14:43389367-43389389 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1116388810 14:44366450-44366472 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1116470147 14:45277146-45277168 AGAATGGCGTGAACCCCGGGAGG + Intergenic
1116562292 14:46395643-46395665 AGAATGGTGTGAACCCCGGGGGG + Intergenic
1116636299 14:47400844-47400866 AGAATGGCGTGAACCCCGGGAGG - Intronic
1116646898 14:47540100-47540122 TGAATGGCGTGAACCCCGGGGGG - Intronic
1116822093 14:49635544-49635566 AGAATGGGGTGAAACCCAGGAGG + Intergenic
1116824200 14:49656264-49656286 AGAATGGCGTGAACCCCGGGGGG + Intronic
1116927060 14:50650485-50650507 ACAAGGGTGTGAATCCCAGGAGG - Intronic
1117269321 14:54125578-54125600 AGAATCGTTTGAACCCCGGGGGG - Intergenic
1117659046 14:57985307-57985329 AGAATCGCTTGAACCCCAGGAGG + Intergenic
1117691296 14:58310003-58310025 AAAATGTTTTCAAACCCAGGTGG + Intronic
1117736797 14:58775972-58775994 AGAATGGTGTGAACCCAGGAGGG + Intergenic
1117997099 14:61488062-61488084 AGAATAGTGTGAACCGCAGGGGG + Intronic
1118027193 14:61781358-61781380 AGAATGGCGTGAACCCCGGGAGG + Intronic
1118040163 14:61907780-61907802 AGAAGGGTGTGAGCCCCAGGGGG + Intergenic
1118561319 14:67086560-67086582 AGAATGGCGTGAACCCCAGGGGG + Intronic
1119055678 14:71417380-71417402 AGAATGGCGTGAACCCCAGGGGG + Intronic
1119232183 14:72989017-72989039 AGAATGGCTTGAACCCCTGGAGG - Intronic
1119298394 14:73551717-73551739 AGAATCGCTTGAACCCCAGGAGG + Intronic
1119412303 14:74440423-74440445 AGAATGGCGTGAACCCGGGGAGG + Intergenic
1119467301 14:74868746-74868768 AGAATGGCGTGAACCCAGGGGGG + Intronic
1119559163 14:75576670-75576692 AGAATGATGGGAAACACAGGAGG + Intergenic
1119597211 14:75946124-75946146 AGAAAGGTCTGAAATGCAGGAGG + Intronic
1119637730 14:76290461-76290483 AGAAGAGTGTGATACCCAGGAGG + Intergenic
1119713452 14:76840670-76840692 AGAATGGTGTGAACCCCGGGGGG - Intronic
1119832527 14:77716225-77716247 AGAATGGCGTGAACCCCAGGGGG + Intronic
1119968033 14:78938932-78938954 AGAATGGCGTGAACCCCAGGGGG - Intronic
1119994196 14:79234471-79234493 AGAATGGCTTGAACCTCAGGAGG - Intronic
1120021999 14:79541312-79541334 AGAATCGCTTGAAACCCAGGAGG + Intronic
1120145405 14:80973314-80973336 AGAATGGCGTGAACCCCGGGGGG + Intronic
1120195715 14:81480276-81480298 AGAATGGCGTGAACCCTGGGGGG - Intronic
1120200287 14:81531641-81531663 AGGATGGAGTGAGCCCCAGGAGG - Intronic
1120206627 14:81594155-81594177 AGAATGAAGAGAAACCCAGCAGG - Intergenic
1120588532 14:86346693-86346715 AGAATTGCTTGAACCCCAGGAGG + Intergenic
1120589694 14:86361457-86361479 AGAATTGCTTGAAACCCGGGAGG - Intergenic
1120741802 14:88117106-88117128 AGAATGGCGTGAACCCCGGGGGG - Intergenic
1120895190 14:89524283-89524305 AGAATGGTGTGAAACCCGGGGGG + Intronic
1121461985 14:94087513-94087535 AGAATGGCGTGAAGCCTGGGAGG - Intronic
1121531363 14:94656603-94656625 AGAATGGCGTGAACCCCATGGGG + Intergenic
1121982244 14:98465068-98465090 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1122065208 14:99168390-99168412 AGAATGGTCAAAAACCCAGTGGG + Intergenic
1122219338 14:100226187-100226209 AGAATCGCTTGAACCCCAGGAGG + Intergenic
1122618260 14:103036239-103036261 AGAATGGTGTGAACCCAGGAGGG - Intronic
1122718798 14:103710650-103710672 AGAATGGTGTGAACCCCGGGAGG + Intronic
1122729809 14:103787740-103787762 AGAATGGCGTAAAACCCGGGAGG - Intronic
1122936662 14:104961423-104961445 AGAATGGCGTGAACCCCGGGGGG + Intronic
1123668263 15:22627481-22627503 AGAATGGTGTGAACCCAGGAGGG + Intergenic
1123693137 15:22855899-22855921 AGAAAGGTGTGAATACCAGGAGG - Intronic
1123830288 15:24129033-24129055 AGAATGGTGTGAACCCCAGGGGG + Intergenic
1123837115 15:24206292-24206314 AGAATGGCATGAACCCCAGGGGG + Intergenic
1123887314 15:24739533-24739555 AGAATGGGGTGAACCCGGGGAGG - Intergenic
1124285944 15:28400235-28400257 AGAATGGTGTGAACCCGGGAGGG + Intergenic
1124296756 15:28511428-28511450 AGAATGGTGTGAACCCGGGAGGG - Intergenic
1124435500 15:29645645-29645667 AGAATGGCGTGAACCCTGGGAGG - Intergenic
1124507840 15:30294035-30294057 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1124530928 15:30505661-30505683 AGAATGGCGTGAACCCCAGGAGG - Intergenic
1124551513 15:30685178-30685200 AGAATGGTGTGAACCCCGGGGGG + Intronic
1124679734 15:31720487-31720509 AGAATGGTGTGAACCCCGGGGGG - Intronic
1124735715 15:32244623-32244645 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1124767729 15:32502034-32502056 AGAATGGCGTGAACCCCAGGAGG + Intergenic
1124967595 15:34448165-34448187 AGAATGGCGTGAACCCCGGGGGG - Intergenic
1125186423 15:36936282-36936304 AGAAAGGCGTGAACCCCGGGAGG - Intronic
1125259701 15:37809038-37809060 AGAATGGCGTGAACCCCAGTGGG + Intergenic
1125525371 15:40370759-40370781 TGAAAGGGGTGAGACCCAGGAGG - Exonic
1125707605 15:41753319-41753341 AGAATCGTTTGAATCCCGGGAGG + Intronic
1125931985 15:43606750-43606772 AGAATGTTGGGAAGCCGAGGTGG + Intronic
1125945084 15:43706225-43706247 AGAATGTTGGGAAGCCGAGGTGG + Intergenic
1126026930 15:44455937-44455959 AGAATGGCGTGAACCCCAGGGGG - Intronic
1126027297 15:44459436-44459458 AGAATGGCTTGAACCCTAGGGGG + Intronic
1126082924 15:44983253-44983275 AGAATCGCTTGAACCCCAGGAGG - Intergenic
1126193548 15:45904781-45904803 AGAGTGGCGTGAACCCCAGGGGG - Intergenic
1126197146 15:45944782-45944804 AGAATGGCGTAAACCCCAGGGGG + Intergenic
1126259415 15:46670909-46670931 AGAATGGCGTGAACCCCGGGGGG - Intergenic
1126366863 15:47903341-47903363 ATAATCGTCTGAAACCTAGGAGG + Intergenic
1126588924 15:50319746-50319768 AGAATCGTTTTGAACCCAGGAGG + Intronic
1126619323 15:50621068-50621090 AGAATGCCGTGAACCCCTGGGGG + Intronic
1126794466 15:52248976-52248998 AGGCAGGTGAGAAACCCAGGTGG - Intronic
1126801128 15:52297235-52297257 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1127044020 15:55007234-55007256 AGAATGGCGTGAACCCCGCGGGG + Intergenic
1127078037 15:55347335-55347357 AGAATCGCTTGTAACCCAGGAGG + Intronic
1127119353 15:55757884-55757906 AGAAGGGCGTGAAACCCGGGAGG + Intergenic
1127126013 15:55812760-55812782 AGAATGGCGTGAACCCCCGGGGG - Intergenic
1127168157 15:56269740-56269762 AGAATGGTGTAAAACCTGGGAGG - Intronic
1127399683 15:58573452-58573474 AGAATTGTTTGAGCCCCAGGAGG - Intergenic
1127486268 15:59420806-59420828 AGAATGGCGTGAACCCCAGGGGG - Intronic
1127510836 15:59639549-59639571 AGAATGGCGTGAACCCCCGGGGG - Intronic
1127778051 15:62284259-62284281 AGAATTGTTTGAATCCCAGGAGG - Intergenic
1127943881 15:63729934-63729956 AGAATTGCTTGAACCCCAGGAGG + Intronic
1128117262 15:65117618-65117640 AGAATGGTGTAAAACCCAGGAGG - Exonic
1128140451 15:65296770-65296792 AGAATGGTGTGAACCCGGGAGGG + Intronic
1128187755 15:65657552-65657574 AGAATGGCGTGAACCCCGGGGGG + Intronic
1128564436 15:68691238-68691260 AGAATGGCGTGAACCCCGGGGGG + Intronic
1128633696 15:69289213-69289235 AGAACCGTGTGAAACCTAGAAGG - Intergenic
1128836424 15:70812577-70812599 AGAATGGCGTGAACCCCGGGAGG + Intergenic
1129010300 15:72409976-72409998 AGAATTGCTTGAAACCCGGGAGG + Intergenic
1129022543 15:72535038-72535060 AGAATGGCATGAACCCCAGGGGG - Intronic
1129136469 15:73556825-73556847 CTAAGGATGTGAAACCCAGGAGG + Intronic
1129146510 15:73652840-73652862 AGAATGGCGTGAACCCCGGGGGG + Intergenic
1129289019 15:74549161-74549183 AGAATGGCGTGAACCCCGGGGGG - Intronic
1129418881 15:75406596-75406618 AGAATGGCGTGAACCCCAGGAGG + Intronic
1129427208 15:75472368-75472390 AGAATGGCGTGAACCCCGGTGGG + Intronic
1129484275 15:75854096-75854118 ACAAGGGTGTGAATGCCAGGAGG + Intronic
1129533643 15:76291659-76291681 AGAATGGCGTGAACCCCGGGGGG + Intronic
1129558475 15:76539632-76539654 AGAATGGCATGAACCCCAAGGGG - Intronic
1129776393 15:78239495-78239517 AGAATGGTGTGAACCTGAGGAGG - Intronic
1130080244 15:80726599-80726621 AGAATGGTGTGAACGCGGGGGGG - Intronic
1130191189 15:81737867-81737889 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1130352721 15:83106397-83106419 AGAATGGCGTGAACCCCGGGAGG + Intergenic
1130683632 15:86018111-86018133 AGAATGGCGTAAAACCTGGGAGG + Intergenic
1131074867 15:89489203-89489225 AGGATCGTTTGAACCCCAGGAGG - Intronic
1131243571 15:90770261-90770283 AGAATGGCGTGAACCCCGGGAGG - Intronic
1131393788 15:92070552-92070574 AGAATTGCTTGAACCCCAGGAGG + Intronic
1131415949 15:92257891-92257913 AGAATGGTGTGAACCCAGGGAGG + Intergenic
1131432528 15:92398042-92398064 AGAATGGCTTGAAACCTGGGAGG + Intronic
1131622967 15:94086989-94087011 AGAATGGCATAAAACCCGGGAGG - Intergenic
1131890195 15:96964332-96964354 AGAATGGCTTGAACCCCGGGGGG + Intergenic
1132036186 15:98486919-98486941 AGAATGGGGTGAATCACATGGGG + Intronic
1132164576 15:99573197-99573219 AGAATGGCGTGAACCCTGGGAGG + Intronic
1132407885 15:101555445-101555467 AGAATGTTGTGAGACACAGAGGG - Intergenic
1132428105 15:101737639-101737661 ACAAGGGTGTGAATGCCAGGAGG - Intronic
1132836422 16:1955634-1955656 AGAATGGTGTGAACCCGGGAGGG - Intronic
1132943927 16:2521871-2521893 AGAATGGCGTGAACCCTGGGGGG - Intronic
1133012749 16:2923945-2923967 AGAATAGCTTGAAACTCAGGAGG + Intronic
1133068623 16:3229774-3229796 AGAATGGCATGAACCGCAGGGGG + Intronic
1133353884 16:5121616-5121638 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1133543214 16:6776320-6776342 AGAATGGTGTGAACCCAGGAGGG + Intronic
1133753069 16:8739627-8739649 AGAATGGGTTAGAACCCAGGAGG + Intronic
1133965216 16:10526223-10526245 AGAATGGCGTGAACCCGGGGGGG + Intergenic
1134259307 16:12638071-12638093 AGAATGGCTTGAACCCCGGGGGG - Intergenic
1134392277 16:13830933-13830955 AGAATGGTGTGAACCCAGGAGGG - Intergenic
1134394550 16:13851223-13851245 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1134483924 16:14641770-14641792 AGAATCGCTTGAACCCCAGGAGG + Intronic
1134857312 16:17531077-17531099 AGAATCACTTGAAACCCAGGAGG + Intergenic
1135014826 16:18916424-18916446 AGAATGGCGTGAACCCCGGGGGG + Intronic
1135028529 16:19017757-19017779 AGACTGGCGTGAACCCCGGGGGG - Intronic
1135163920 16:20121887-20121909 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1135340839 16:21646742-21646764 AGAATCGCTTGTAACCCAGGAGG - Intronic
1135430228 16:22376045-22376067 AGAATTGCTTGAAACCCGGGAGG + Intronic
1135837573 16:25841092-25841114 AGAATGGCATGAACCCCGGGGGG - Intronic
1136047592 16:27626873-27626895 AGAATCGCTTGAACCCCAGGAGG + Intronic
1136224954 16:28853910-28853932 AGAATGGCGTAAAACCCGGGAGG + Intronic
1136407887 16:30059407-30059429 AGAATGCTGTAAAACCCGGGAGG + Intronic
1136475029 16:30507368-30507390 AGAATGGCATGAACCCCAGGGGG + Intronic
1136735054 16:32459599-32459621 AGAATGGCGTGAACCCCGGGGGG - Intergenic
1137011665 16:35327778-35327800 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1137389500 16:48069647-48069669 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1137475578 16:48805549-48805571 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1137773018 16:51033149-51033171 AGAATCGCTTGAACCCCAGGAGG - Intergenic
1137809823 16:51342491-51342513 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1137831609 16:51549025-51549047 AGAATGGTGTGAACCCGGGAGGG - Intergenic
1137840460 16:51636393-51636415 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1138136072 16:54523768-54523790 AGAATCGCTTGAAACCCAGGAGG + Intergenic
1138425001 16:56925736-56925758 AGAATTGCTTGAACCCCAGGAGG - Intergenic
1138462717 16:57161599-57161621 AGAATGGCATTGAACCCAGGAGG - Intronic
1138614411 16:58153144-58153166 AGGATGGCGTGAACCCCGGGAGG + Intergenic
1138780476 16:59779106-59779128 AGAATGGCGTAAAACCCGGAAGG - Intergenic
1138827262 16:60335235-60335257 AGAATGGCGTGAACCCCGGGAGG + Intergenic
1138897202 16:61221588-61221610 AGAATGGCGTGAACCCCGGGGGG - Intergenic
1139372748 16:66479004-66479026 AGGATGGGCTCAAACCCAGGTGG - Intronic
1139452167 16:67037755-67037777 AGAATAGCTTAAAACCCAGGAGG - Intronic
1139456425 16:67081908-67081930 AGAATAGCTTAAAACCCAGGAGG - Intronic
1139695599 16:68672101-68672123 AGAATGGCGTGAACCCCAGGGGG + Intronic
1139707690 16:68752925-68752947 AGGATGCTGAGATACCCAGGGGG - Intronic
1139820070 16:69714257-69714279 AGAATTGCTTGAAACCCAGGAGG - Intronic
1139904048 16:70350965-70350987 AGAATGGTTATGAACCCAGGAGG - Intronic
1140076709 16:71707041-71707063 AGAATGGCGTGAACCCCAGGGGG - Intronic
1140077992 16:71720056-71720078 AGAATGGCATGAACCCCGGGGGG - Intronic
1140356491 16:74311310-74311332 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1140380390 16:74481872-74481894 AGAATGGTGTAAAACCCGGGAGG - Intronic
1140460504 16:75135902-75135924 AGAATCGCCTGAAACCCAAGAGG - Intergenic
1140499171 16:75418393-75418415 AGAATGGCGTAAAACCCGGGAGG - Intronic
1140810692 16:78574343-78574365 ACAATGGTGTGAATACCAGGTGG + Intronic
1141120700 16:81353200-81353222 AGAATGGCGTGAACCCCAGGGGG + Intronic
1141220769 16:82067637-82067659 AGGAGGGTGAGAAACACAGGTGG + Intronic
1141252039 16:82367957-82367979 AGAATGGTGTGAACCCCGGGGGG + Intergenic
1141287969 16:82690249-82690271 AGAATGGTGAGACAACCAGTGGG + Intronic
1141454565 16:84131766-84131788 AGAATGGCGTGAACCCCAGGGGG - Intronic
1141465356 16:84202263-84202285 AGAATGGCGTAAACCCCAGGGGG - Intergenic
1141579582 16:84988079-84988101 AGAATGGCATGAACCCCTGGGGG + Intronic
1142209680 16:88803130-88803152 AGAATGGCGTGAACCCCGTGGGG - Intergenic
1203018025 16_KI270728v1_random:369994-370016 AGAATGGCGTGAACCCCGGGGGG + Intergenic
1203036360 16_KI270728v1_random:643152-643174 AGAATGGCGTGAACCCCGGGGGG + Intergenic
1142594924 17:1025030-1025052 AGAATGGCGTGAACCCCAGGGGG + Intronic
1142663994 17:1451101-1451123 AGAATGGCATGAACCCCACGGGG + Intronic
1142718007 17:1757920-1757942 AGAATGGCATGAACCCCGGGGGG - Intergenic
1142823596 17:2492806-2492828 AGAATTGCTTGAACCCCAGGAGG + Intronic
1143083754 17:4400501-4400523 AGAATGGCGTGAACCCCAGAGGG - Intergenic
1143298943 17:5895000-5895022 AGAATGGCGTGAACCCCAGGGGG - Intronic
1143308221 17:5966007-5966029 AGAATGGTGTGAACCCCCAGGGG - Intronic
1143346384 17:6252394-6252416 AGAATGGTGTGAACCCCGGCGGG + Intergenic
1143360243 17:6363405-6363427 AGAATGGCGTGAACCCCGGGAGG + Intergenic
1143416420 17:6754272-6754294 AGAATGGCGTGAACCCAGGGTGG - Intergenic
1143459145 17:7089332-7089354 AAAATGGCGTGAACCCCGGGGGG + Intergenic
1143465847 17:7135773-7135795 AGAATGGTGTGGTCGCCAGGGGG + Intergenic
1143726598 17:8851405-8851427 AGAATGGCGTGAACCCCGGGAGG + Intronic
1144127662 17:12217941-12217963 AGAATAGCTTGAACCCCAGGGGG + Intergenic
1144144112 17:12380801-12380823 AGAATGGCGTGAACCCCGGGGGG - Intergenic
1144234888 17:13250410-13250432 AGAATGGCGTGAACCCCGGGGGG + Intergenic
1144311621 17:14019176-14019198 AGAATTGTTTGAACCCCGGGAGG + Intergenic
1144477649 17:15602714-15602736 AGAATGGCGTGAACCCCAGGGGG - Intronic
1144487166 17:15676522-15676544 AGAATGGCGTGAACCCCAGGAGG - Intronic
1144612391 17:16733412-16733434 AGAATGGCGTGAACCCTGGGTGG + Intronic
1144710109 17:17395978-17396000 ACAAGGGTGTGAATGCCAGGAGG + Intergenic
1144774780 17:17779862-17779884 AGAATGGCGTGAACCCCGGGGGG - Intronic
1144829931 17:18125613-18125635 AGAATGGCGTGAACCCCAGGAGG + Intronic
1144868393 17:18352233-18352255 AGAATGGCGTGAACCCCAGGGGG - Intronic
1144900338 17:18581876-18581898 AGAATGGCGTGAACCCTGGGTGG - Intergenic
1144903660 17:18622127-18622149 AGAATGGCATGAACCCCAGGGGG + Intergenic
1144913868 17:18705796-18705818 AGAATGGCGTGAACCCCAGGAGG + Intronic
1144924677 17:18795113-18795135 AGAATGGCTTGAACCCCAGGAGG - Intronic
1144927403 17:18823858-18823880 AGAATGGCATGAACCCCAGGGGG - Intergenic
1145128916 17:20324602-20324624 AGAATGGCATGAACCCCAGGGGG - Intergenic
1145132108 17:20363804-20363826 AGAATGGCATGAACCCTAGGTGG + Intergenic
1145195753 17:20893009-20893031 AGAATGGCATGAACCCCAGGGGG + Intronic
1145735623 17:27229044-27229066 AGAATGGTGTGAACCCCGGGGGG + Intergenic
1145767328 17:27467898-27467920 AGAATGGAATGGAACCCAGGAGG - Intronic
1145949042 17:28801362-28801384 AGAATGGTGTGAACCCCGGGGGG + Intronic
1145992607 17:29088141-29088163 AGAATGGCGTGAACCCCGGGGGG - Intronic
1146007369 17:29169137-29169159 AGAATGGCGTGAACCCTGGGAGG - Intronic
1146030943 17:29365509-29365531 AGAATGGTGTGAACCCTGGGAGG - Intergenic
1146101456 17:29986734-29986756 AGAATGGCGTGAACCCCAGGGGG - Intronic
1146184144 17:30714020-30714042 AGAATGTTGGGAAGCCGAGGTGG + Intergenic
1146188740 17:30746547-30746569 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1146214281 17:30966582-30966604 AGAATGGTGTGAACCCTGGGAGG - Intergenic
1146237798 17:31184558-31184580 AGAATGGCGTGAACCCCAGGGGG + Intronic
1146241678 17:31234585-31234607 AGAATGGTGTGAACCCAGGAGGG + Intronic
1146333629 17:31950867-31950889 AGAATGGCGTGAACCCCGGCGGG - Intronic
1146339271 17:32006226-32006248 AGAATGGCGTAAAATCCGGGAGG - Intergenic
1146352789 17:32109923-32109945 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1146409925 17:32573939-32573961 AGAATGGCGTGAACCCTGGGGGG - Intronic
1146508520 17:33426020-33426042 AGAATGCTGAGGAACACAGGAGG - Intronic
1146795279 17:35775961-35775983 AGAATGGTGTGAACCCGGGGAGG - Intronic
1146840334 17:36148187-36148209 AGAATGATGTGAAACCTTGGGGG - Intergenic
1147032960 17:37655878-37655900 AGAATGGCGTGAACCCAAGGAGG + Intergenic
1147127322 17:38380539-38380561 AGAATCGCTTAAAACCCAGGAGG + Intronic
1147186300 17:38715128-38715150 AGAATGGGTGGAAAGCCAGGGGG + Intronic
1147404375 17:40200396-40200418 AGAATGGCGTGAAACCGGGAGGG + Intergenic
1147439910 17:40441758-40441780 AGAATCGCTTGAACCCCAGGAGG - Intergenic
1147452235 17:40512831-40512853 AGAATGGCGTGAAACCCGGGAGG - Intergenic
1147490213 17:40859060-40859082 AGAATGGTGTGAGACTCAAAGGG - Intergenic
1147737818 17:42652061-42652083 AGAATGGCGTGAACCCCGGGGGG - Intergenic
1147750912 17:42732677-42732699 AGAATGGCGTGAACCCCAGGGGG + Intronic
1147999404 17:44379033-44379055 AGAATGGCGTGAACCCCGGGGGG - Intronic
1148037984 17:44682765-44682787 AGAATGGCGTGAACCCGGGGAGG + Intronic
1148121475 17:45214874-45214896 AGAATGGCGTAAAACCCGGGAGG - Intergenic
1148176402 17:45569335-45569357 AGAATGGTGTGAACCCGGGAGGG + Intergenic
1148294974 17:46493624-46493646 AGAATGGTGTGAACCCGGGAGGG - Intergenic
1148509820 17:48158869-48158891 AGAATGGCGTGAACCCCAGGGGG + Intronic
1148527423 17:48353806-48353828 AGAATTGCTTAAAACCCAGGAGG + Intronic
1148534130 17:48424312-48424334 AGAATGGTGTGAACCCGGGAGGG - Intronic
1149054282 17:52344127-52344149 AGAATGGCGTGAACCCCAGGAGG - Intergenic
1149617891 17:58016873-58016895 AGAATGGTGTAAAACCTGGGAGG + Intergenic
1149767797 17:59294468-59294490 AGAATGGCGTGAACCCCGGGGGG + Intergenic
1149899679 17:60462859-60462881 AGAATGATGTGAACCCTGGGGGG + Intronic
1150052365 17:61977538-61977560 AGAATGGTGTGAACCCGGGAGGG - Intronic
1150081803 17:62246394-62246416 AGAATCGCTTGAACCCCAGGAGG + Intergenic
1150106537 17:62466518-62466540 AGAATCACTTGAAACCCAGGAGG + Intronic
1150221666 17:63499080-63499102 AGAATCGCTTGAAAGCCAGGAGG - Intronic
1150273057 17:63879148-63879170 AGAATGTCATGAACCCCAGGGGG - Intronic
1150407628 17:64916314-64916336 AGAATGGTGTGAACCCGGGAGGG + Intronic
1150428135 17:65093674-65093696 AGAATGGCTTGAACCCCGGGGGG - Intergenic
1150681922 17:67291447-67291469 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1150689607 17:67353394-67353416 AGAATCGCTTGAACCCCAGGAGG - Intronic
1150917261 17:69449700-69449722 AGAATGGCGTGAACCCCAGGGGG - Intronic
1150970673 17:70023947-70023969 AGAATGGCGTGAACCCGGGGGGG - Intergenic
1151211988 17:72551317-72551339 ACAATGGCGTGAATCCCGGGGGG - Intergenic
1151217852 17:72590035-72590057 AGAATGGCGTGAATCCCGCGGGG + Intergenic
1151523209 17:74645898-74645920 AGAATGGTGTGAACCCCAGGGGG + Intergenic
1151690685 17:75683130-75683152 AGAATTGCTTGAACCCCAGGAGG - Intronic
1151739133 17:75967378-75967400 AGAATGGCTTTGAACCCAGGAGG + Intronic
1151746833 17:76016053-76016075 AGAATTGCTTGAACCCCAGGAGG + Intronic
1151794292 17:76332978-76333000 AGAATGGCGTGAACCTCGGGGGG - Intronic
1151897711 17:76991545-76991567 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1152035774 17:77871665-77871687 AGAATTGCTTGAACCCCAGGAGG + Intergenic
1152329555 17:79664433-79664455 AGAATGGCGTGAACCCCGGGGGG - Intergenic
1152680059 17:81662908-81662930 AGAATGGCTTTGAACCCAGGAGG + Intronic
1152914818 17:83028433-83028455 AGAATGGCGTGAACCCCAGGGGG + Intronic
1153296005 18:3547210-3547232 AGAATGGCTTGAACCCCCGGGGG + Intronic
1153408512 18:4767496-4767518 AGAATGGCGTGAACCCGGGGCGG - Intergenic
1153671002 18:7411968-7411990 AGAATCGCTTGAACCCCAGGAGG - Intergenic
1153926119 18:9836681-9836703 AGAATGGAGTGGAACACATGGGG + Intronic
1154064152 18:11090822-11090844 AGAATGGTGTGAACCCGGGGGGG + Intronic
1154292893 18:13126222-13126244 AGAATCATTTGAATCCCAGGTGG - Intergenic
1154481537 18:14831088-14831110 AGAATGGCATGAACCCCGGGAGG + Intronic
1154997015 18:21649848-21649870 AGAATGGCGTGAACCCCGGGGGG + Intergenic
1155148076 18:23100553-23100575 AGAATGGTGTGAACCCGGGATGG - Intergenic
1155862707 18:30923360-30923382 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1155948015 18:31877521-31877543 AGAATGGCATGAACCCCGGGGGG + Intronic
1156687729 18:39670044-39670066 AGAATGGCGTGACCCCCGGGAGG + Intergenic
1157334100 18:46724724-46724746 AGAATTTTGGGAAACCGAGGTGG + Intronic
1157358556 18:46957341-46957363 AGAATGGCGTGAACCCCGGGGGG - Intronic
1158039354 18:53073434-53073456 AGAATGGTATGAAACCTGGGGGG + Intronic
1158301479 18:56057851-56057873 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1158349909 18:56554590-56554612 AGAATTGCTTGAACCCCAGGGGG - Intergenic
1158424585 18:57327616-57327638 AGAATGGCGTGAACCCCAGGAGG - Intergenic
1158424920 18:57330352-57330374 AGAATCACCTGAAACCCAGGAGG - Intergenic
1158698144 18:59720885-59720907 AGAATCGTTTGAATCCCAGGTGG + Intergenic
1158874908 18:61724091-61724113 AGAAGGGTGTGAAGACCAAGCGG - Intergenic
1159156737 18:64592958-64592980 AGAATGGCGTGAACCCCGGGAGG + Intergenic
1159173150 18:64798800-64798822 AGAATTGCTTGAACCCCAGGAGG + Intergenic
1159278898 18:66258409-66258431 AGAATGGCGTGAACCCCGGGGGG + Intergenic
1159400797 18:67931445-67931467 AGAATGGCGTGAAACCTGGGAGG - Intergenic
1159420911 18:68218229-68218251 AGAATGGCGTGAACCCGGGGAGG + Intergenic
1159565400 18:70042462-70042484 AGAATGGTGTGAACCCGGGACGG - Intronic
1159658131 18:71057327-71057349 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1159701688 18:71637055-71637077 AGAATGGCGTGAAACCAGGGGGG + Intergenic
1160192998 18:76730541-76730563 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1160334150 18:78022474-78022496 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1160628206 18:80227848-80227870 TGAATGGTCTGAAGCCCTGGTGG - Intronic
1160780548 19:876090-876112 AGAAACGCGTGAGACCCAGGCGG - Intronic
1160934744 19:1588687-1588709 AGAATTGGGTTGAACCCAGGAGG + Intronic
1160964128 19:1738432-1738454 AGAATGGCGTGAACCCGGGGGGG + Intergenic
1161183985 19:2903802-2903824 AGAATGGCGTGAACCCCGGAGGG - Intronic
1161214392 19:3086340-3086362 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1161225569 19:3143561-3143583 AGAATCGCTTGAAACCCATGAGG + Intronic
1161249230 19:3271333-3271355 AGCAGGGTGTGGTACCCAGGTGG + Intronic
1161259544 19:3329644-3329666 AGAATTGTTTGAAACCCAGGAGG + Intergenic
1161299366 19:3535408-3535430 AGGATGCCGTGAAGCCCAGGTGG - Intronic
1161439175 19:4280614-4280636 AGAATCGCTTGAACCCCAGGAGG - Intronic
1161639194 19:5409885-5409907 AAAATGGCCTGAACCCCAGGAGG - Intergenic
1161729162 19:5948361-5948383 AGAACGGCGTGAACCCCAGGAGG + Intronic
1161785585 19:6323329-6323351 AGAATGGTGTGAACCCTAGGGGG + Intronic
1161785647 19:6323879-6323901 TGAATGCTGTGTGACCCAGGAGG - Intronic
1161794314 19:6377711-6377733 AGAATCGCTTGGAACCCAGGAGG + Intronic
1161824612 19:6554046-6554068 AGAATGGTGTGAACCCTGGGGGG - Intergenic
1162101989 19:8344443-8344465 AGAATCGCTTGAACCCCAGGAGG - Intronic
1162197716 19:8998519-8998541 AGAATGGCGGTGAACCCAGGAGG + Intergenic
1162217324 19:9147427-9147449 AGAATGGTGTGAAACCCAGGAGG - Intronic
1162221845 19:9183866-9183888 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1162406066 19:10474597-10474619 AGAGTGGCGTGAACCCCGGGGGG + Intergenic
1162421939 19:10570458-10570480 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1162558677 19:11403122-11403144 AGAATGGCGTGAACCCCGGGGGG - Intronic
1162573559 19:11486037-11486059 AGAATGGTGTGAACCCGGGGGGG - Intronic
1162692667 19:12446985-12447007 AGAATGGCGTGAACCCCAGGGGG - Intronic
1162694275 19:12460253-12460275 AGAATTGCTTGAACCCCAGGAGG - Intronic
1162698027 19:12492268-12492290 AGAATGGCGTGAACCCCGGGGGG - Intronic
1162735299 19:12743816-12743838 AGAATGGCATGAACCCCAGGGGG - Intronic
1162741462 19:12775964-12775986 AGAATGGCGTGAACCCCAGGGGG - Intronic
1162800353 19:13106910-13106932 AGAATGGCGTGAACCCCGGGGGG - Intronic
1162832330 19:13293533-13293555 AGAATGGTGTAAAACCCGGGAGG - Intronic
1162974639 19:14201661-14201683 AGAATGTTGGGAAGCCGAGGTGG - Intronic
1163036101 19:14569978-14570000 AGAATTGGCTGGAACCCAGGAGG - Intronic
1163053670 19:14703113-14703135 AGAATGGCGTGAACCCCAGGGGG + Intronic
1163086834 19:14987376-14987398 AGAATTGCTTGAACCCCAGGAGG + Intronic
1163268903 19:16237642-16237664 AGAATCATTTGAACCCCAGGAGG + Intronic
1163475203 19:17521764-17521786 AGAATGGCATAAAACCCAGGAGG + Intergenic
1163590144 19:18188700-18188722 AGAATGGCGTGAACCCGGGGAGG - Intergenic
1163818833 19:19484620-19484642 AGAATGGCATGAACCCCGGGGGG - Intronic
1163915476 19:20237393-20237415 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1163971218 19:20797293-20797315 AGAATGGCGTGAACCCCAGGGGG - Intronic
1164037805 19:21469251-21469273 AGAATGGCGTGAACCCAAGGAGG - Intronic
1164215631 19:23143153-23143175 AGAATGGTGTGAACCCCGGGAGG + Intronic
1164264603 19:23602170-23602192 AGAATCGCTTGAACCCCAGGGGG + Intronic
1164318673 19:24118140-24118162 AGAATCGCTTGAAACCCGGGAGG - Intronic
1164745421 19:30609203-30609225 AGACTTGTTTGAACCCCAGGAGG + Intronic
1164948712 19:32318081-32318103 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1165019609 19:32912951-32912973 AGAATGGCGTGAACCCCGGGGGG + Intronic
1165147867 19:33743388-33743410 AGAATGGCATGAACCCCCGGGGG - Intronic
1165197104 19:34112667-34112689 AGCATGGTGTGAAAGTCAGGTGG + Intergenic
1165221868 19:34323118-34323140 AGAATGGCGTGAACCCCGGGGGG - Intronic
1165239978 19:34458469-34458491 AGAATGGCGTGAACCCCAGGGGG + Intronic
1165300668 19:34966501-34966523 AGAATGGCATGAACCCCGGGAGG + Intergenic
1165323928 19:35103140-35103162 AGAATGGTGTGAACCCCGGGGGG - Intergenic
1165497627 19:36162807-36162829 AGAATGGCGTGAACCCTGGGAGG + Intergenic
1165546303 19:36539250-36539272 AGAATGGTGTGAGGCGGAGGCGG + Intronic
1165557576 19:36648090-36648112 AGAATCGCTTGAAACCGAGGTGG + Intronic
1165573354 19:36793622-36793644 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1165687499 19:37834573-37834595 AGAATGGCGTGAACCCCAGGAGG + Intergenic
1165737757 19:38187626-38187648 AGAATGGCGTGAACCCCAGGGGG + Intronic
1165762362 19:38329139-38329161 AGAATGGCGTGAACCCCGGTGGG + Intergenic
1166058203 19:40306876-40306898 AGAATGGCGTGAACCCCGGGGGG - Intergenic
1166189892 19:41169589-41169611 AGAATGGCGTGAACCCCGAGAGG - Intergenic
1166377843 19:42337593-42337615 AGAATGGCGTGAAACCCGGGGGG - Intronic
1166394272 19:42427258-42427280 AGGATGGAGTGAAACCCAAGAGG - Exonic
1166402375 19:42492980-42493002 AGAATGGTGTGAACCCAGGAAGG - Intergenic
1166408700 19:42542098-42542120 AGAATGGCGTGAACCCCGGGGGG - Intronic
1166641358 19:44497747-44497769 AGGATGGGGTGAACACCAGGGGG - Intronic
1166839825 19:45690240-45690262 AGAATGGCGTGAACCCCAGGGGG + Intronic
1166858777 19:45797289-45797311 AGAATGGCGTGAACCCTGGGAGG + Intronic
1167179842 19:47894534-47894556 AGAATGGCGTAAAATCCAGGAGG - Intergenic
1167443980 19:49526576-49526598 AGAATGGCGTGAACCCAGGGAGG - Intergenic
1167481874 19:49737703-49737725 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1167519850 19:49947798-49947820 AGAATCGCTTGAAACCCGGGAGG + Intronic
1167773476 19:51538492-51538514 AGAAAGGTGTGGAACCCAGCAGG + Intergenic
1167886333 19:52502979-52503001 AGAATTGCTTGAAACCCAGAGGG - Intronic
1167990499 19:53356838-53356860 AGAATGGCGTGAACCCAGGGGGG + Intergenic
1168180180 19:54657089-54657111 AGAATGGTGTGAACCCCGAGGGG - Intronic
1168282022 19:55311048-55311070 AGAATCATTTGAAACCCGGGAGG - Intronic
1168310482 19:55457443-55457465 AGAATCGCTTGAAGCCCAGGAGG + Intronic
1168468022 19:56619690-56619712 AGAGTGGTCTCAAACTCAGGTGG + Intronic
1168576033 19:57511137-57511159 AGAATGGCATGAATCCCAGGGGG - Intronic
1168578615 19:57534864-57534886 TGAATGGTGTGCAACCGGGGAGG + Intronic
1168598471 19:57698881-57698903 AGAATTGTTTGAACCCCGGGAGG - Exonic
1168621556 19:57883267-57883289 AGAATGGCATGAACCCCAGGGGG + Intronic
1168698882 19:58423247-58423269 AGAATGGCGAGAACCCCGGGAGG - Intergenic
1202699343 1_KI270712v1_random:151974-151996 AGAATAGTGTGACCCCCGGGAGG - Intergenic
925144143 2:1569730-1569752 AGAATTGCTTGAAACCCAGGAGG + Intergenic
925296551 2:2781008-2781030 TGCAGGGTGTGAAGCCCAGGAGG - Intergenic
925306641 2:2851494-2851516 AGAGGAGGGTGAAACCCAGGAGG - Intergenic
925401040 2:3573467-3573489 AGAATGGCGTGAACCGCCGGGGG - Intergenic
925410180 2:3635278-3635300 AGATTGGGGAGACACCCAGGAGG - Intronic
925631195 2:5895259-5895281 AGAATGGCGTGAACCCCAGGGGG - Intergenic
925724224 2:6857722-6857744 AGAATGGCATGAACCCCAGGGGG - Intronic
926118433 2:10227848-10227870 AGAATGGTGTGAACCCCGGGAGG - Intergenic
926448136 2:12969640-12969662 AGAATCATGTGAACCCAAGGGGG - Intergenic
926736197 2:16074838-16074860 AGAGTGGAGTGAACCCCGGGGGG + Intergenic
926835812 2:17018643-17018665 AGAATGGCGTGAACCCCAGGGGG + Intergenic
927115089 2:19891761-19891783 AGAATCCCTTGAAACCCAGGAGG + Intergenic
927422258 2:22945852-22945874 AGAATGGCGTGAACCCCGGGGGG + Intergenic
927541415 2:23914751-23914773 AGAATGGCGTGAACCCCGGGGGG + Intronic
927542325 2:23924092-23924114 AGAATGGCGTGAACCCCGGGGGG + Intronic
927560387 2:24068050-24068072 AGAATGGCGTGAACCCCAGGGGG - Intronic
927629827 2:24763448-24763470 AGAATGGCATGAACCCCGGGGGG + Intronic
927668174 2:25046590-25046612 AGAATGGCGTGAACCCCAGGGGG - Intronic
927753264 2:25688606-25688628 AGAATGGAGTGAACCCCAGGGGG - Intergenic
928156460 2:28881251-28881273 AAAATGGCGTGAACCCCGGGGGG + Intergenic
928162392 2:28940020-28940042 AGAATGGCGTGAACCCGGGGGGG + Intronic
928289584 2:30025706-30025728 AGAATGGCGTGAACTCCAGGGGG - Intergenic
928501043 2:31895930-31895952 AGAGTGGTGTGAACCCCGGGGGG - Intronic
928545150 2:32322514-32322536 AGAATGGCGTGAACTCCAGAGGG + Intergenic
928565150 2:32537875-32537897 AGAATGGCCTGAACCCCAGAGGG + Intronic
928701767 2:33905717-33905739 AGAATTGCTTGAACCCCAGGAGG - Intergenic
928768241 2:34673538-34673560 AGAATCGCTTAAAACCCAGGGGG + Intergenic
929106424 2:38370063-38370085 AGAATGGCGTGAACCCCGGGGGG + Intronic
929137328 2:38637449-38637471 AGAATGGCGTGAACCCCGGGGGG + Intergenic
929520599 2:42647065-42647087 AGAATGGCGTGGAACCCAGGAGG + Intronic
929724462 2:44410344-44410366 AGAAGGGGGTGAACCCCTGGGGG - Intronic
929854149 2:45621613-45621635 AGAATGGTGTGAACCCAGGGAGG + Intergenic
930074772 2:47397663-47397685 AGAATCGCTTTAAACCCAGGTGG - Intergenic
930240532 2:48931721-48931743 AGAATGGCGTGAACCACAGGGGG - Intergenic
930415096 2:51080564-51080586 AGAATGGTGTGAATCCGGGAGGG + Intergenic
930515753 2:52405801-52405823 AGAATGGCGTGAACCCCGGGGGG + Intergenic
930591738 2:53335564-53335586 AGAATTGCTTGAAACCCAGTGGG + Intergenic
930705945 2:54505197-54505219 AGAATGGTGTGAATACTTGGTGG + Intronic
930727105 2:54693122-54693144 AGAATGGCGTGAAACCCAGGAGG - Intergenic
930887984 2:56350254-56350276 AGAATTGCTTAAAACCCAGGAGG - Intronic
931307876 2:61049682-61049704 AGAATTGCTTGAACCCCAGGAGG + Exonic
931367892 2:61635393-61635415 AGAATCGCTTGAACCCCAGGAGG - Intergenic
931398224 2:61907193-61907215 AGAATGGCTCGAACCCCAGGAGG - Intronic
931731911 2:65160837-65160859 AGAATGGCGTTGAACCCGGGAGG + Intergenic
931781180 2:65580471-65580493 AGAATGGCGTGAACCCCAGGGGG - Intergenic
931907860 2:66862285-66862307 AGAATGGCGTTGAACCCAGGAGG - Intergenic
931958862 2:67459338-67459360 AGAATTGCTTGAAACCCGGGAGG - Intergenic
932041322 2:68302934-68302956 AGAATGGCGTGAACCCCGGGGGG - Intronic
932060584 2:68494185-68494207 AGAATTGCTTGAACCCCAGGGGG + Intronic
932225188 2:70034063-70034085 AGAATGGCGTGAACCCCGGGGGG + Intergenic
932241081 2:70157363-70157385 AGAATGGCGTGAACCCCAGGGGG + Intronic
932245033 2:70189626-70189648 AGAATGGCGTGAACCCTGGGGGG + Intronic
932278080 2:70466416-70466438 AGAATGGCGAGAACCCCGGGGGG + Intronic
932381156 2:71284550-71284572 ACAACGGTGTGAATACCAGGAGG - Intronic
932561567 2:72876236-72876258 AGAATGGCGTGAGCCCCGGGGGG - Intergenic
932760066 2:74433576-74433598 AGAATGGCATGAACCCCAGGAGG - Intronic
932798741 2:74720684-74720706 AGAATTGCTTGAACCCCAGGAGG + Intergenic
932817952 2:74876665-74876687 AAAATGGTGTGAAAACCACCTGG - Intronic
933298367 2:80515972-80515994 AGAATAGTGTGAAAGAGAGGTGG - Intronic
933299718 2:80528283-80528305 AGAATTGCTTGAACCCCAGGAGG - Intronic
933452067 2:82467247-82467269 AGAATGGCGTGAACCCCGAGGGG + Intergenic
933593728 2:84261381-84261403 AGAATGGCGTGAACCCCAGGGGG + Intergenic
933726946 2:85432487-85432509 AGAATGGCGTGAACCCCAGGGGG - Intronic
933878639 2:86645788-86645810 ACAAAGGTGTGAATACCAGGAGG - Intronic
933881302 2:86672739-86672761 GGAATGGTGTGGATTCCAGGTGG + Intronic
934248930 2:90329811-90329833 AGAATGGTATGAAAGCCTGTTGG + Intergenic
934260649 2:91473665-91473687 AGAATGGTATGAAAGCCTGTTGG - Intergenic
934649791 2:96084330-96084352 ATGATGGGGTGGAACCCAGGGGG - Intergenic
934683175 2:96300672-96300694 AGAATGGCGCGAAACCTGGGAGG + Intronic
935204081 2:100882521-100882543 AGAATGGCGTAAAACCCGGGAGG + Intronic
935221620 2:101019981-101020003 AGAATGGTGTGGAACCCGGGAGG + Intronic
935258898 2:101337562-101337584 AGAATCGCTTGAACCCCAGGAGG + Intergenic
935668297 2:105533787-105533809 AGAATGGCGTGAACCCTGGGGGG - Intergenic
935808878 2:106775678-106775700 AGAATTGCTTGAAACCCGGGAGG + Intergenic
936029450 2:109059484-109059506 AGAATGGTGTGAATCCCGGGAGG + Intergenic
936284370 2:111170608-111170630 AGAATGGCGTGAACCCCGGGGGG + Intergenic
936400048 2:112157984-112158006 AGAATGGCGTGAACCCCGGGGGG - Intronic
936407022 2:112214033-112214055 AGAATGGTGTGAACCCCAGGGGG - Exonic
936784697 2:116080439-116080461 AGAAAGGTTTGAAACCCAACAGG - Intergenic
936846433 2:116840594-116840616 AAAATGCTGTGAAATTCAGGTGG + Intergenic
936912893 2:117611010-117611032 AGAATGGCGTGAACCCCAGGGGG + Intergenic
937092429 2:119215477-119215499 AGGATTGTTTGAACCCCAGGAGG - Intergenic
937395573 2:121531504-121531526 AGAATGGCGTGAATCCGGGGGGG + Intronic
937402025 2:121592739-121592761 AGAATGGCGTGAACCCTGGGGGG - Intronic
937518247 2:122680285-122680307 AGAATGGCATGAACCCCCGGGGG + Intergenic
937563009 2:123247775-123247797 AGAATGGTGTGAACCCTGGGAGG + Intergenic
937696127 2:124810555-124810577 ACAAGGGTGTGAATACCAGGAGG + Intronic
938394159 2:130929980-130930002 AGAATGGCGGGAACCCCGGGAGG - Intronic
938413699 2:131086974-131086996 AGAATGGTGTGAACCCCAGGGGG + Intronic
938486483 2:131714906-131714928 AGAATGGCGTGAACCCCGGGGGG + Intergenic
938943125 2:136186816-136186838 AGAATCGCTTGAACCCCAGGAGG - Intergenic
938991721 2:136636471-136636493 ACAAGGGTGTGAATACCAGGAGG + Intergenic
939475118 2:142677160-142677182 AGAATGGCGTGAACCCCAGGGGG - Intergenic
939480766 2:142744537-142744559 AGAATCGTTTGAACCCCAGGGGG - Intergenic
939491573 2:142883281-142883303 AGAATGGCGTGAACCCCGGGGGG - Intronic
940242042 2:151574061-151574083 AGAATGGCGTGAAACCCAGGAGG - Intronic
940342750 2:152598598-152598620 AGAATTGCTTGAAACCCGGGAGG + Intronic
940660457 2:156538730-156538752 AGAATGGTGTGAATCCAGGAGGG + Intronic
940748730 2:157599243-157599265 AGAATGGCGTGAACCCGAGAGGG + Intronic
940846025 2:158643176-158643198 AGATTGGTGAGGAACACAGGTGG + Intronic
940907389 2:159181383-159181405 AGAATGGTGTGAACCCCAGGGGG - Intronic
941234198 2:162948471-162948493 AGAATGGTGTGAACCCCGGGGGG + Intergenic
941446189 2:165602982-165603004 AGAATGGCGTGAACCCCGTGGGG - Intronic
941521492 2:166550201-166550223 AGAATGGCGTGAACGCCGGGGGG - Intergenic
941729286 2:168898484-168898506 AGAATCGCTTGAAACCCGGGAGG - Intronic
941893897 2:170610249-170610271 AGAATGGCGTGAACCCCGGAGGG + Intronic
942047993 2:172111135-172111157 AGAATGGCGTGAACCCCAGGGGG + Intergenic
942339697 2:174930852-174930874 AGAATGGCATAAAACCCAAGAGG - Intronic
942345637 2:175000228-175000250 AGAATCGCTTGAACCCCAGGAGG - Intronic
942466055 2:176208503-176208525 AGAATGGCGTGAACTCCAGGGGG + Intergenic
942524420 2:176838360-176838382 AGAATTGCTTGAACCCCAGGAGG + Intergenic
942871304 2:180737355-180737377 ACAATGGCGTGAACCCCGGGGGG - Intergenic
943017645 2:182532854-182532876 AGAATGGCGTGAACCCCGGGAGG + Intergenic
943456972 2:188120423-188120445 GGAATGGCGTGAACCCCAGGGGG - Intergenic
943512807 2:188847277-188847299 AGAATGGTGTGAATCCGGGACGG - Intergenic
943632608 2:190271376-190271398 AGAATCGCTTGAAACCCGGGAGG - Intronic
944025872 2:195166678-195166700 AGAATGGCGTGAACCCCAGGGGG - Intergenic
944092085 2:195922949-195922971 AGAATTGCTTGAACCCCAGGAGG - Intronic
944109867 2:196120955-196120977 AGAATTGCTTGAACCCCAGGTGG - Intergenic
944237280 2:197452159-197452181 AGAATGGCGTGAACCCCAGGGGG - Intergenic
944403079 2:199350932-199350954 AGAATCGCTTGAACCCCAGGAGG + Intronic
944487100 2:200218381-200218403 AGAATGGCGTGAACCCCGTGGGG + Intergenic
944553687 2:200867711-200867733 AGAATTGTTTGAACCCCGGGAGG - Intergenic
944701144 2:202247441-202247463 AGAATGGTGTGAACCCAGGAGGG - Intergenic
944702149 2:202255401-202255423 AGAATGGCGTAAAACCCAGGAGG - Intergenic
944704181 2:202272239-202272261 AGAATGGCGTGAACCCCAGGGGG - Intronic
944706865 2:202298541-202298563 AGAATTGCTTGAAACCCGGGAGG + Intronic
944715228 2:202371123-202371145 AGAATGGCGTGAAACACGGGAGG - Intergenic
944730666 2:202514223-202514245 AGAATGGCGTGAACCCTGGGGGG - Intronic
944744866 2:202645376-202645398 AGAATGGCGTGAACCCCGGGGGG - Intronic
944816752 2:203385218-203385240 AGAATGGCGTGAAACCTGGGAGG - Intronic
944833021 2:203551429-203551451 AGAATGGTGTGAACCCCGCAGGG + Intergenic
944992554 2:205254751-205254773 AGAATGGCGTGAACCCCGGGGGG - Intronic
945302829 2:208230124-208230146 AGAATGGCATGAACCCCGGGGGG + Intergenic
945392495 2:209280921-209280943 AGAATGGCGTGAACCCCGTGGGG - Intergenic
945540295 2:211077665-211077687 AGAATGATTTGAGACCAAGGAGG - Intergenic
945551498 2:211227043-211227065 AGAATGGCGTGAACCCCAGGGGG - Intergenic
945877852 2:215296827-215296849 AGAATGGCGTGAACCCCGGGGGG + Intergenic
945879177 2:215309112-215309134 AGAATGGCATGAACCCCGGGGGG - Intergenic
945911131 2:215651030-215651052 AGAATGGCGTGAATCCCGCGGGG - Intergenic
946052411 2:216874763-216874785 AGAATAGTTTGAAATCCATGAGG + Intergenic
946272922 2:218609051-218609073 AGAATAGCGTGAACCCCGGGGGG + Intronic
946411804 2:219518991-219519013 AGAATGGCATGAACCCCGGGGGG - Intronic
946724879 2:222652373-222652395 ACAAGGGTGTGAATACCAGGAGG - Intronic
946835628 2:223769831-223769853 AGAATGGCGTGAACCCCGGGGGG - Intronic
946929548 2:224658271-224658293 AGAATGGCGTGAACCCCGGGAGG - Intergenic
947059740 2:226149998-226150020 AGAATGGTGTAAAACCCAGGAGG + Intergenic
947489501 2:230581455-230581477 AGAATGGCGTGAACCCCGGGGGG + Intergenic
947517823 2:230822678-230822700 AGAATGGTGTGAACCCGAGGTGG - Intergenic
947986546 2:234452738-234452760 AGAATTGCTTGAAACCCAGAAGG - Intergenic
947997285 2:234539068-234539090 ACAATGGTGTGAATACCAGGAGG - Intergenic
948116542 2:235497681-235497703 AGAATGGCGTGAACCCGGGGCGG - Intronic
948249176 2:236511871-236511893 AGAATCGCTTGAACCCCAGGAGG - Intergenic
948913179 2:241016282-241016304 AGAATAGCGTGAACCCCGGGTGG - Intronic
1168776202 20:449504-449526 AGAGTCGCTTGAAACCCAGGAGG + Intronic
1169179930 20:3555088-3555110 AGAATGGCGTGAACCCCAGGGGG - Intronic
1169181143 20:3568200-3568222 AGAATGATGTGAACCCCAGGAGG + Intronic
1169615952 20:7445509-7445531 AGAATGGCGTGAACCCTGGGAGG + Intergenic
1169736673 20:8845023-8845045 AGAATGGTGTGAACCCGGGATGG + Intronic
1169893914 20:10482090-10482112 ATAAGGGTGTGAAAACCAGGAGG + Intronic
1170035148 20:11981795-11981817 AGAATCATTTGAAACCCAGGAGG - Intergenic
1170036807 20:11998167-11998189 AGACAGGGGTGAAAACCAGGGGG + Intergenic
1170082291 20:12490423-12490445 ACAAGGGTGTGAAGACCAGGAGG - Intergenic
1170107937 20:12772198-12772220 AGAATGGTGTGAACCCCGTGGGG - Intergenic
1170167229 20:13374435-13374457 AGAATGGTGTGAACCCCGGGAGG - Intergenic
1170547827 20:17450115-17450137 AGAATGGCGTGAACCCCAGGGGG - Intronic
1170619120 20:17979496-17979518 AGAATGGCGTGAACCCGAGGCGG - Intronic
1170677928 20:18499644-18499666 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1170866067 20:20159483-20159505 AGAAAGGTGTGAAACCCATGGGG - Intronic
1171061211 20:21962282-21962304 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1171863670 20:30457247-30457269 AGAATGGCGTGAACCTCAGGGGG - Intergenic
1172048342 20:32097488-32097510 AGAATGGCGTGAAAGCCGGGAGG + Intronic
1172316734 20:33961202-33961224 AGAATCGCTTGAACCCCAGGAGG + Intergenic
1172555420 20:35836753-35836775 AGAATGGCGTGAACCCCCGGCGG + Intronic
1172558507 20:35865101-35865123 AGAATTGCTTGAAACCCAGGAGG + Intronic
1172751642 20:37255570-37255592 AGAATGGTGTGAACCCGGGAGGG + Intronic
1172996379 20:39072994-39073016 AGCATGCTGTGAAGTCCAGGGGG - Intergenic
1173036662 20:39418200-39418222 AGAAGGTAGTGAAACCCTGGAGG + Intergenic
1173116487 20:40248298-40248320 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1173219196 20:41117473-41117495 AGAATGGCGTGAACCCCAGGAGG - Intronic
1173833826 20:46112213-46112235 ATAAGGGTGTGAAGACCAGGAGG + Intergenic
1173876940 20:46379080-46379102 AGAATTGCTTGAAACCCGGGAGG - Intronic
1173910948 20:46670391-46670413 ACAAGGGTGTGAATACCAGGAGG - Intronic
1174165208 20:48579393-48579415 AGAATGGCGTGAACCCTGGGGGG - Intergenic
1174247997 20:49196345-49196367 AGAATGGCGTGAACCCCGGGGGG + Intergenic
1174312305 20:49667338-49667360 AGAATGGCGTGAACCCCTGGGGG - Intronic
1174324023 20:49764744-49764766 AGAATGGCGTAAAACCCGGGAGG - Intergenic
1174372844 20:50104566-50104588 AGAATGGCGTGAACCCCAGGGGG + Intronic
1174632141 20:51967409-51967431 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1174824819 20:53759550-53759572 AGAAAGGCGTGAACCCCGGGGGG - Intergenic
1174960811 20:55154907-55154929 AGAATGGCGTGAACCCGGGGGGG - Intergenic
1175116561 20:56686889-56686911 AGAATGGCGTGAACCTCGGGGGG - Intergenic
1175143873 20:56881378-56881400 AGAATGGTGAGAACCCAGGGAGG - Intergenic
1175231875 20:57478958-57478980 AGAATCGCTTGGAACCCAGGAGG + Intergenic
1175886287 20:62292955-62292977 AGAATGGTGTGAACCCGGAGGGG - Intronic
1176068503 20:63213435-63213457 AAAAAGGACTGAAACCCAGGCGG + Intronic
1176149785 20:63584534-63584556 AGAATGGTGTGAAACCGGGGAGG - Intergenic
1176606255 21:8834613-8834635 AGAATGGCTTGAATCCCAGAAGG + Intergenic
1176799069 21:13405516-13405538 AGAATGGCGTGAACCCCGGGAGG - Intergenic
1177157084 21:17511455-17511477 AGAATGGCGTGAACCCCGGGAGG - Intergenic
1177174745 21:17691442-17691464 AGAATGGCGTGAACCCCGGGGGG - Intergenic
1177200306 21:17946328-17946350 AGAATGGCGTGAACCCCCGGGGG + Intronic
1177205300 21:18003032-18003054 AGAATGGCGTGAACCCCGGGGGG + Intronic
1177315783 21:19459109-19459131 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1177488966 21:21796635-21796657 AGAATGGTGTGAACCCGGGAGGG + Intergenic
1177545391 21:22551387-22551409 AGAATGGCGGTGAACCCAGGAGG - Intergenic
1177648750 21:23933957-23933979 AGAATGGCGTGAACCCCGGGAGG + Intergenic
1177715500 21:24835768-24835790 AGAATGGCGTGAACCCCTGGGGG - Intergenic
1177835910 21:26185936-26185958 AGAATGACCTGAAAACCAGGTGG - Intergenic
1177925585 21:27210633-27210655 AGAATGGTGTCAAAAAAAGGAGG - Intergenic
1177945817 21:27468618-27468640 AGAATGGCGTGGAACCTGGGAGG + Intergenic
1177973372 21:27817708-27817730 AGAATGGTGTGAATCCAGGAGGG + Intergenic
1178074704 21:29004086-29004108 AGAATCGCTTGAACCCCAGGCGG + Intergenic
1178325338 21:31641215-31641237 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1178342939 21:31801418-31801440 AGAATCGCTTGAACCCCAGGAGG + Intergenic
1178470914 21:32891844-32891866 ACAAGGGTGTGAATACCAGGAGG - Intergenic
1178559062 21:33620992-33621014 AGAATGGCGTGAACCCCAGGGGG - Intronic
1178586297 21:33874064-33874086 AGAATTGCTTGAAACCCGGGAGG + Intronic
1178611460 21:34085689-34085711 AGAATGGCGTGAAACCCGGGAGG - Intronic
1178808842 21:35862329-35862351 AGCAAGGTGAGAAACCGAGGAGG + Intronic
1178836361 21:36100813-36100835 AGAATGGCGTTGAACCCGGGAGG + Intergenic
1179158738 21:38874531-38874553 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1179202968 21:39244151-39244173 AGAATGGCATTGAACCCAGGAGG - Intronic
1179327266 21:40360219-40360241 AGAATGGTGTGAACCCCGGGAGG - Intronic
1180206250 21:46262876-46262898 AGAATGGCGTGAACCCCGGGGGG + Intronic
1180211656 21:46298516-46298538 AGAATGGCGTGAACCCCGGCGGG - Intergenic
1180303527 22:11055448-11055470 AGAATGGTGTGAACCTGGGGAGG - Intergenic
1180672616 22:17565167-17565189 AGAATGGCGTGAACCCGGGGGGG - Intronic
1180698409 22:17768781-17768803 AGAATGGCGTGAAACTCGGGAGG + Intronic
1180736257 22:18019899-18019921 AGAATGGCGTGAACCCCGGGGGG - Intronic
1180791942 22:18579586-18579608 AGAATGGCGTGAACCCCGGGGGG + Intergenic
1180792785 22:18585773-18585795 AGAATGGCGTGAACCCCAGGAGG + Intergenic
1181038433 22:20180839-20180861 AGCATGAAGTGAAACCCAGTGGG + Intergenic
1181091551 22:20476500-20476522 AGAATGGTGTGAACCCCGGGGGG - Intronic
1181228951 22:21409546-21409568 AGAATGGCGTGAACCCCAGGAGG - Intergenic
1181229794 22:21415723-21415745 AGAATGGCGTGAACCCCGGGGGG - Intergenic
1181248855 22:21519143-21519165 AGAATGGCGTGAACCCCGGGGGG + Intergenic
1181249700 22:21525319-21525341 AGAATGGCGTGAACCCCAGGAGG + Intergenic
1181382504 22:22518012-22518034 AGAATGGCGTGAACCCCGCGGGG - Intronic
1181576247 22:23797085-23797107 AGAATGGCGTGAACCCCAGGGGG - Intronic
1181662902 22:24366280-24366302 AGAATGGCATGAACCCCAGGGGG - Intronic
1181703553 22:24634280-24634302 AGCATTGTGTGTAACCCAGCAGG - Intergenic
1181761415 22:25061341-25061363 AGGATAGGGTGCAACCCAGGAGG - Intronic
1182100435 22:27654010-27654032 AGAATGGCGTGAACCCCGGGAGG + Intergenic
1182135541 22:27899409-27899431 AGAATGGCGTGAACCCAAAGTGG - Intronic
1182217249 22:28729451-28729473 AGAATGGCGTGAACCCCAGGGGG + Intronic
1182337292 22:29592719-29592741 AGAATGGCGTAAACCCCGGGGGG - Intergenic
1182359216 22:29736936-29736958 AGAATGGCGTGAACCCCAAGAGG + Intronic
1182412791 22:30201504-30201526 AGAATGGCGTGAACCCCGCGGGG - Intergenic
1182514850 22:30850215-30850237 AGAATTGCTTGAAACCCAGGAGG + Intronic
1182524121 22:30905233-30905255 AGAATTGCTTGAACCCCAGGAGG - Intronic
1182943990 22:34305250-34305272 AGAATGGTGTGAACCCTGGGGGG - Intergenic
1183012170 22:34955762-34955784 AGAATGGCGTGAAACCTAGGAGG + Intergenic
1183155718 22:36073380-36073402 AGAATCATTTGAAACCCAGGAGG + Intergenic
1183344588 22:37300370-37300392 AGGACTGTGTGAAGCCCAGGAGG + Intronic
1183389211 22:37534974-37534996 AGAATTGCTTGAACCCCAGGAGG + Intergenic
1183599883 22:38833763-38833785 AGAATGGCGTGAACCCCAGGGGG - Intronic
1183757347 22:39780908-39780930 AGAATGGTGTGAACCCAGGAGGG + Intronic
1183997913 22:41649764-41649786 AGAATGGCGTGAACCCCGGTGGG + Intronic
1184127349 22:42497026-42497048 AGAATCGCGTGAAAACCAGAAGG + Intergenic
1184374209 22:44101318-44101340 AGAATGGCATGAACCCCGGGGGG + Intronic
1184623054 22:45697717-45697739 AGAATGGCGTGAACCCCAGGGGG - Intronic
1184755533 22:46513879-46513901 AGAATGGCGTGAACCCCGGGAGG - Intronic
949186892 3:1202449-1202471 AGAATGGCGGGAACCCCGGGGGG + Intronic
949598890 3:5577609-5577631 AGAATGGCTTGAAGCCCGGGAGG - Intergenic
949757173 3:7425522-7425544 GAAATAGTGTGAAACCAAGGTGG + Intronic
950041587 3:9923085-9923107 AGAATGGCTTGAACCCCAGGAGG + Intronic
950416314 3:12870799-12870821 AGACAGGTGGGAACCCCAGGAGG - Intronic
950626289 3:14249591-14249613 AGAATGGTGTGAACCCGGGAAGG - Intergenic
950838884 3:15947757-15947779 AGAATGGCATGAACCCCGGGGGG + Intergenic
950901513 3:16502467-16502489 ACAAGGGTGTGAATACCAGGAGG - Intronic
950966626 3:17151301-17151323 AGAATTGCTTGAAACCCAGGAGG + Intergenic
951267596 3:20588034-20588056 AGAATGGCGTCAACCCCAGAAGG - Intergenic
951382986 3:22008440-22008462 AGAATGTTGTGAACTCCGGGGGG - Intronic
951519742 3:23600226-23600248 GGAAGGGTCTGGAACCCAGGGGG - Intergenic
951553539 3:23898530-23898552 AGAATCGCTTGAAACCCGGGAGG - Intronic
952057533 3:29466321-29466343 AGACGAGTGTGAAACACAGGAGG - Intronic
952145311 3:30525808-30525830 AGAATGGCGTGAACCCCAGGGGG + Intergenic
952150803 3:30588504-30588526 AGAATGGCGCGAACCCCAGGGGG - Intergenic
952381656 3:32810056-32810078 AGAATGGTGTGAACCCCGGGGGG - Intergenic
952417407 3:33101789-33101811 AGAATGGCGTGGAACCCGGGAGG + Intergenic
952434586 3:33259646-33259668 AGAATGGCGTGAACCCCAGGGGG + Intergenic
952456494 3:33477578-33477600 AGAATGGCGTGAACCCCGGGGGG + Intergenic
953318557 3:41951053-41951075 AGAATGGCGTGAACCCCGGGAGG + Intronic
953321742 3:41978847-41978869 AGAATGGCGTGAACCCTGGGAGG - Intergenic
953478325 3:43225727-43225749 AGAATGGCGTGAACCCCAGGGGG - Intergenic
953496442 3:43391503-43391525 ACAAAGGAGTGAATCCCAGGAGG - Intronic
953508772 3:43513597-43513619 AGAATGGCGTGAACCCTTGGAGG - Intronic
953574045 3:44098486-44098508 AAAATGGTGGCAAACCCATGGGG - Intergenic
953608253 3:44426052-44426074 AGAATGGTGTGAACCCGGGGAGG - Intergenic
953956902 3:47238748-47238770 AGAATGGTGTAAAACCCGGGAGG - Intronic
953977054 3:47389749-47389771 AGAATGGCGTGAACCCGGGGGGG + Intronic
953978818 3:47403139-47403161 AGAATGGCGTGAACCCCCGGGGG - Intronic
954086987 3:48252709-48252731 AGAATGGCGTGAACCCCAGGGGG - Intronic
954309290 3:49752397-49752419 AGAATGGCGTGGAACCTGGGAGG + Intronic
954617990 3:51980009-51980031 AGAATGGCATGAACCCCGGGGGG - Intronic
954695024 3:52419517-52419539 AGAATGGCGTGAACCCGAGAGGG - Intronic
954898819 3:54001270-54001292 AGAATGGCGTGAACCCCGGGGGG - Intergenic
954899512 3:54006983-54007005 AGAATGGCGTGAACCCCGGGGGG - Intergenic
954941875 3:54380647-54380669 AGAATGGTGTGAACCCGGGAGGG + Intronic
955044462 3:55346802-55346824 AGAATGGCGTGAACCCCAGGGGG + Intergenic
955112741 3:55965164-55965186 ACAAGGGTGTGAAAACCAGGGGG + Intronic
956156114 3:66299279-66299301 AGAATCGCTTGGAACCCAGGAGG - Intronic
956395439 3:68821434-68821456 AGAATGGCGTGAACCCCAGGGGG - Intronic
956797475 3:72729905-72729927 AGAATGGCGTGAACCCCGGGGGG - Intergenic
957059029 3:75466522-75466544 AGAATGGCGTGAACCCCGGGAGG + Intergenic
957462953 3:80546055-80546077 AGAATCGCTTGAACCCCAGGTGG - Intergenic
957747333 3:84362753-84362775 AGAATGGCGTGAACCCCAGGAGG - Intergenic
957781797 3:84827858-84827880 AAAATGGTTTGAAAACTAGGAGG + Intergenic
957883714 3:86255725-86255747 AGAATGGCGTGAACCCCAGGAGG - Intergenic
957886425 3:86294197-86294219 AGAATGGCGTGAACCCCAGGAGG + Intergenic
957977461 3:87465416-87465438 AGAATGGCGTGAACCCCAGGGGG + Intergenic
958054816 3:88396192-88396214 AGAATGGCGTGAACCCCAGGGGG - Intergenic
958457821 3:94354887-94354909 ACAATGTTGTGAAACCCATACGG + Intergenic
958547435 3:95572639-95572661 AGAATGGCGTGAACCCAGGGAGG - Intergenic
958557721 3:95702051-95702073 GGAATGGTCTGAAAAGCAGGTGG + Intergenic
958766418 3:98373361-98373383 AGAATGGCGTGAACCCCGGGGGG - Intergenic
958989137 3:100821690-100821712 AGAATTGCTTGAACCCCAGGAGG - Intronic
959018714 3:101165242-101165264 AGAATGGCGTGAACCCCGGGGGG - Intergenic
959055407 3:101562560-101562582 AGAATGGCGTGAACCCTGGGAGG + Intronic
959700135 3:109290980-109291002 AGAATGGCATGAACCCCGGGGGG - Intergenic
959896541 3:111613049-111613071 AGAATGTTGTGTGCCCCAGGTGG - Intronic
959935881 3:112027711-112027733 AGAATGGTGTGAACCCGGGAGGG + Intergenic
960061714 3:113329759-113329781 AGGATGGTGTGAAAAGCAGAGGG + Intronic
960064937 3:113361582-113361604 AGAATGGCGTGAAACCTGGGAGG - Intronic
960107830 3:113816986-113817008 AGAATTGCTTGAACCCCAGGAGG + Intergenic
960194439 3:114747827-114747849 AGAATGGCGTGAACCCCAGGGGG + Intronic
960226535 3:115175773-115175795 AGAATGGCATGAACCCCGGGGGG + Intergenic
960347836 3:116556627-116556649 AGAATGGCGTGAACCCCAGGGGG + Intronic
960447545 3:117766208-117766230 AGAATGGCGTGAACCCCAGGGGG + Intergenic
960473436 3:118095117-118095139 AGAATGGCGTGAACCCGAGGAGG + Intergenic
960655372 3:119998190-119998212 ACAAGGGTGTGAATACCAGGAGG - Intronic
960802738 3:121555651-121555673 AGAATGGCGTGAACCCCAGGGGG - Intergenic
960805267 3:121577872-121577894 AGAATCGCTTGAACCCCAGGAGG - Intronic
961246531 3:125458723-125458745 AGAATGGCGTGAATCCCGGGGGG + Intronic
961250531 3:125500708-125500730 AGAATGGTGTGAACCCCAGAGGG + Intronic
961294418 3:125873209-125873231 AGAATGGCATGAACCCCGGGAGG - Intergenic
961715183 3:128853092-128853114 AGAATGGCGTGAACCCCCGGGGG - Intergenic
961759368 3:129154151-129154173 AGAATGGCGTGAACCCCGGGGGG + Intronic
961891547 3:130134267-130134289 AGAATGGCATGAACCCCAGGAGG + Intergenic
961953331 3:130773266-130773288 AGAATGGCGTGAACCCCAGGGGG - Intergenic
962182927 3:133227280-133227302 AGAATGGCGTGAACCCCAGGGGG - Intronic
962218223 3:133541188-133541210 AAAGTGGTGTGAATACCAGGAGG - Intergenic
962251019 3:133836184-133836206 AGCATGGTGTGAGACCCTTGTGG + Intronic
962545120 3:136426319-136426341 AGAATGGCGTGAACCCCCAGGGG + Intronic
962682257 3:137812671-137812693 AGAATCGCTTGAACCCCAGGAGG - Intergenic
962791710 3:138817247-138817269 AGAATGGCATGAACCCCGGGGGG + Intronic
962871935 3:139504609-139504631 AGAATGGCGTGAATCCCGGGAGG - Intergenic
963166854 3:142212921-142212943 AGAATGGCGTGAACCCCAGGGGG - Intronic
963185537 3:142411909-142411931 AGAATGGCGTGAACCCCCGGGGG - Intronic
963189595 3:142454528-142454550 AGAATGGCGTGAACCCCAGGGGG - Intronic
963336994 3:143986633-143986655 AGAATGGCGTGAACCCCAGGGGG + Intronic
963448860 3:145451813-145451835 AGAATGGCATGAAACCAGGGAGG - Intergenic
963533905 3:146504116-146504138 AGAATGGCGTGAACCCCGGGAGG - Intergenic
963737416 3:149035567-149035589 AGAATGGCCTGAACCCCGGGAGG + Intronic
963739093 3:149057018-149057040 AGAATGGCGTGAACCCCAGGGGG + Intronic
964015417 3:151939613-151939635 AGAATCGCTTGAAACCCAGGAGG - Intergenic
964096321 3:152935568-152935590 AGAATTGCTTGAAACCCGGGGGG - Intergenic
964112435 3:153101603-153101625 AGAATGGCTTGAACCCCGGGGGG + Intergenic
964352154 3:155814057-155814079 AGAATGGCGTGAACCACAGGGGG - Intergenic
964352454 3:155816313-155816335 AGAATGGCGTGAACCCCAGGGGG + Intergenic
964365376 3:155945269-155945291 AGAATGGCGTGAACCCCAGGGGG + Intergenic
964366395 3:155955074-155955096 AGAATGGCATCGAACCCAGGAGG - Intergenic
964411081 3:156398501-156398523 AGAATGGCATGAACCCCGGGGGG + Intronic
964568662 3:158088491-158088513 AGAATGGCGTGAACCCCAGGAGG + Intergenic
964674688 3:159264825-159264847 TGAACGGCTTGAAACCCAGGAGG + Intronic
964737268 3:159929762-159929784 AGAATGGTGTGAACTCCACAAGG + Intergenic
964811440 3:160668974-160668996 AGAATGGCGTGAAACCCGGGAGG - Intergenic
964838772 3:160970877-160970899 AGAATGGCGTGAACCCCAGGGGG - Intronic
964928458 3:161985469-161985491 AGAATGGCGTGAACCCCAGGGGG - Intergenic
965090327 3:164153524-164153546 AGAATGGCGTGAACCCCAGGGGG + Intergenic
965544141 3:169898288-169898310 AGAATGGCGTGAACCCCGGGGGG + Intergenic
965958917 3:174405551-174405573 AGAATGGCGTGAACCCCGGGGGG + Intergenic
966182730 3:177201320-177201342 AGAATGGCTTGAAACCGAGAGGG + Intergenic
966196539 3:177319482-177319504 AGAATGGGGTGAACCCTCGGGGG + Intergenic
966219257 3:177534507-177534529 AGAATGGCGTGAACCCCGGGGGG - Intergenic
966350519 3:179029069-179029091 AGAATTGCTTGAAACCCAGGAGG + Intronic
966377686 3:179313471-179313493 AGAATGGCGTGAACCCCGGGGGG + Intergenic
966830733 3:184006132-184006154 CGATTGGTGTGGAGCCCAGGTGG - Intronic
966837096 3:184057643-184057665 AGAATGGCGTGAAACTCGGGAGG + Intronic
967142556 3:186573472-186573494 AGAATGGCGTAAAACCCAGGAGG - Intronic
967177870 3:186876340-186876362 AGAATGGCGTGAACTCCAGGGGG - Intergenic
967254942 3:187581161-187581183 AGAATCGCTTGAACCCCAGGAGG + Intergenic
967415898 3:189218200-189218222 AGAATGGTGTGAACCCCGGGAGG - Intronic
967470695 3:189858314-189858336 AGAATGGCGTGAACCCCAGGGGG + Intronic
967779242 3:193418226-193418248 AGAATGGCGTGAACCCCGAGGGG + Intronic
968330108 3:197861059-197861081 AGAATCGCTTTAAACCCAGGAGG - Intronic
968398562 4:267213-267235 AGAATGGTGTGAACCCTGGGGGG + Intergenic
968511834 4:999114-999136 AGAATGGTGTGAACCCGGGAGGG + Intronic
968587002 4:1423612-1423634 AGAATGGCATGAACCCCAGGGGG - Intergenic
968669366 4:1840576-1840598 AGAATGGTGTGGACCCCGGGGGG + Intronic
969029508 4:4200384-4200406 AGAATAGTGTGACTCCCGGGAGG + Intronic
969372834 4:6744949-6744971 AGAATGGTGTGAACCCGGGAGGG + Intergenic
969400693 4:6953540-6953562 AGAATGGCGTGAACCCCAGGGGG + Intronic
969520339 4:7674482-7674504 AGAATGGTGTGAACCCGGGGGGG + Intronic
969751079 4:9111813-9111835 AGAATGGCGTGAACCCCAGGAGG - Intergenic
969810991 4:9648105-9648127 AGAATGGCGTGAACCCTGGGAGG - Intergenic
970081742 4:12294828-12294850 AGAATGGCGTGAACCCCGGGGGG + Intergenic
970213313 4:13733110-13733132 AGAATGGCGTTGAACCCGGGAGG - Intergenic
970415500 4:15852897-15852919 AGAATGGCGTGAACCCCAGGGGG - Exonic
970607519 4:17694432-17694454 AGAATGGTGTGAACCCAGGAGGG + Intronic
970660096 4:18275708-18275730 AGAATGGCATGAACCCCGGGGGG - Intergenic
970774165 4:19653090-19653112 AGAATTGCTTGAAGCCCAGGAGG - Intergenic
970946100 4:21693471-21693493 AGAATTGATTAAAACCCAGGAGG + Intronic
971148151 4:24002214-24002236 AGAATGGCTTGAACCCCAGGAGG - Intergenic
971252627 4:24986068-24986090 AGAATGGCGTGAACCCCAGGGGG - Intergenic
971289639 4:25325152-25325174 AGAATGGCGTGAATCCCGGGAGG + Intronic
971315797 4:25566965-25566987 GGAATGGCGTGAACCCCAGGGGG - Intergenic
971407486 4:26335707-26335729 AGAATGGCGTAAAACCCAGGAGG - Intronic
971482654 4:27128081-27128103 AGAATCGTTTGAACCCCAAGAGG - Intergenic
971736215 4:30455833-30455855 AGAATGGCGTGAACCCCGGGGGG + Intergenic
972176136 4:36408979-36409001 AGAATGGCGTGAACCCCGGGAGG - Intergenic
972194928 4:36641904-36641926 AGAATGGCGTGAACCCGCGGGGG + Intergenic
972214299 4:36877922-36877944 AGAAGGATGTGAACACCAGGAGG + Intergenic
972328884 4:38045212-38045234 AGAAAGGTGTGAAACTCTGAGGG - Intronic
972508105 4:39740451-39740473 AGAATGGCGTGAACCCCGGGAGG + Intronic
972625383 4:40792660-40792682 AGAATGGCTTGAACCCCGGGGGG + Intronic
972735648 4:41838411-41838433 AGAATTGCTTAAAACCCAGGAGG + Intergenic
972770687 4:42194350-42194372 AGAATGGCGTGAACCCCGGGGGG - Intergenic
972777521 4:42256844-42256866 AGAATGGCATGAACCCCAGGAGG - Intergenic
972878699 4:43396700-43396722 AGAATGGCGGGAACCCCGGGAGG + Intergenic
972920163 4:43929671-43929693 AGAATGGTGTGAACCCGGGAGGG - Intergenic
973059231 4:45699672-45699694 AGAATGGCGTGAACCCCAGGGGG - Intergenic
973622661 4:52742825-52742847 AGAATGGCATGAACCCAAGGGGG + Exonic
973761154 4:54117066-54117088 AGAATGGCGTGAACCCCGGGGGG - Intronic
974070759 4:57121426-57121448 AGAATCGCTTGAACCCCAGGAGG - Intergenic
974484203 4:62485631-62485653 AGAATGGCGTGAACCCCGGGAGG + Intergenic
974910821 4:68117376-68117398 AGAATGGAGTGAACCCTGGGTGG + Intronic
975122381 4:70743156-70743178 AGAATTGCTTGAACCCCAGGAGG - Intronic
975229825 4:71919417-71919439 AGAATGACGTGAACCCCGGGGGG + Intergenic
975600933 4:76098668-76098690 AGAATTGCTTGAAACCCGGGAGG + Intronic
975602668 4:76118914-76118936 AGAATGGCGGAAAACCCGGGAGG + Intronic
975859373 4:78659903-78659925 AGAATGGTGGTAAAACCAGGAGG + Intergenic
976028610 4:80722809-80722831 AGAATGGCGTGAACCCCGGGGGG + Intronic
976171032 4:82304577-82304599 AGAATGGCGTGAACCCCGGGGGG - Intergenic
976247629 4:83019546-83019568 AGAATGTCGTGAATCCCAGGGGG + Intergenic
976307441 4:83574963-83574985 AGAATGGCGTGAACCCCAGGGGG - Intronic
976410053 4:84703005-84703027 AGAATGGCATGAACCCCAGGGGG + Intronic
976428026 4:84928935-84928957 ACAAGGGTGTGAATACCAGGAGG - Intronic
976671663 4:87661308-87661330 AGAATGGCGTGAACCCCAGGGGG - Intronic
976765780 4:88595936-88595958 AGAATGGCATGAACCCCGGGGGG - Intronic
976958141 4:90930521-90930543 AGAATGGTGTAAAACCAGGGAGG + Intronic
977197036 4:94076288-94076310 AGAATGGCGTGAATCCCGGAGGG + Intergenic
977315645 4:95444418-95444440 AGAATGGCGTGAAGCCAGGGGGG - Intronic
977372805 4:96161624-96161646 AGAACGGCGTGAACCCCGGGGGG + Intergenic
977553449 4:98466117-98466139 AGAATGGTGTGAACCCAGGAGGG - Intergenic
977636539 4:99304576-99304598 AGAATGGCGTGAACCCCGGGGGG + Intergenic
978145266 4:105365145-105365167 AGAATGGCGTGAACCCCGGGGGG - Intergenic
978311486 4:107388731-107388753 ACAAGGGTGTGAATCCCAGCAGG - Intergenic
978364752 4:107969804-107969826 AGAATTGCTTGAACCCCAGGAGG + Intergenic
978516827 4:109577697-109577719 AGAATGGCGTGAACCCCGGGGGG - Intronic
978553096 4:109949154-109949176 AGAATTGCTTAAAACCCAGGAGG - Intronic
978787434 4:112625494-112625516 AGAATGGCGTGAAACCCGGGAGG + Intronic
978967179 4:114754406-114754428 AGAATGGCGTGAACCCCGGGGGG + Intergenic
978969613 4:114787293-114787315 AGAATGGCGTAAAACCTGGGAGG - Intergenic
979009293 4:115346403-115346425 AGAATGTTGTGAACCCGGGGAGG - Intergenic
979333905 4:119445828-119445850 AGAATTGTTTGAACCCCGGGGGG + Intergenic
979564229 4:122136107-122136129 AGAATGGCGTGAACCCGAGGCGG + Intergenic
979755771 4:124338767-124338789 AGAATGGCGTTGAACCCGGGAGG - Intergenic
979772353 4:124543467-124543489 AGAATGGCGTGAACCCTGGGGGG + Intergenic
979815421 4:125096556-125096578 AGAATGGTTTGAACCCTGGGAGG - Intergenic
980048076 4:128011235-128011257 AGAATGGTGTGAACCCTGGGGGG - Intronic
980050150 4:128031376-128031398 AGAATGGCATAAAACCCGGGAGG + Intronic
980104679 4:128576229-128576251 AGAATGTTGTGAACCCCGGGAGG + Intergenic
980471334 4:133256462-133256484 AGAATGGCGTGAACCCCGCGGGG - Intergenic
980694944 4:136342347-136342369 AGAATGGCGTGAACCCCCGGGGG + Intergenic
980726027 4:136761800-136761822 AGAATGGTGTGAACCCGGGAAGG + Intergenic
980821190 4:138019731-138019753 AGAATGGCGTGAACCCCGGGGGG + Intergenic
980825510 4:138067121-138067143 AGAATGGCGTGAACCCCAGGGGG + Intergenic
980935738 4:139224092-139224114 ACAATGGTATGAATACCAGGAGG + Intergenic
981327124 4:143462748-143462770 AGAATCATTTGAAACCCAGGAGG - Intronic
981449523 4:144880038-144880060 AGAATGGCGTGAACCCCGGGGGG + Intergenic
982041264 4:151399200-151399222 AGAATGGCGTGAACCCTGGGGGG + Intergenic
982237480 4:153265430-153265452 AGAATGGTGTGAATCCAGGAGGG - Intronic
982242815 4:153317558-153317580 AGAATGGTGTGAACCCCGGGAGG + Intronic
982424698 4:155244960-155244982 AGAATGGTGTGAGAGACAGAGGG + Intergenic
982495082 4:156080999-156081021 AGAATGGCGTGAACCCCAGGGGG - Intergenic
982506611 4:156226545-156226567 AGAATGGCGTGAACCCCGGGAGG + Intergenic
982739556 4:159043434-159043456 AGAATGGCGTGAACCCTGGGAGG - Intergenic
982747714 4:159121947-159121969 AGAATGGCGTAAAACCCGGGAGG + Intronic
983198763 4:164838032-164838054 ACAAGGGTGTGAATACCAGGAGG - Intergenic
983216174 4:165004922-165004944 AGAATGGCGTGAACCCCGGGGGG + Intergenic
983226324 4:165089408-165089430 AGAATGGCGTGAAACCTGGGAGG - Intronic
983226596 4:165091176-165091198 AGAATGGCCTGAAACCCGGGAGG + Intronic
983272471 4:165579183-165579205 AGAATCGCTTGAAACCCGGGAGG - Intergenic
983327186 4:166272344-166272366 AGAATGGCATGAACCCAAGGAGG - Intergenic
983418127 4:167484123-167484145 AGAATGGCGTGAACCCCAGGGGG - Intergenic
983619951 4:169750578-169750600 ATAATGGTCTGGAACTCAGGAGG + Exonic
983634890 4:169887458-169887480 AGAATGGCGTGAACCCCAGGGGG + Intergenic
983840594 4:172453110-172453132 AGAATCGTTTAGAACCCAGGAGG + Intronic
984039913 4:174719050-174719072 AGAATGGGGTGAACCCCAGGGGG - Intronic
984077209 4:175197677-175197699 AGAATGGCGTGAAACCCAGGAGG + Intergenic
984153723 4:176167555-176167577 AGAATGGCGTGAACCCCAGGGGG + Intronic
984384877 4:179043797-179043819 AGAATGGCGTGAACCCCAGGGGG - Intergenic
984696862 4:182787643-182787665 AGAATGGCTTGAACCCCGGGAGG + Intronic
984849417 4:184141189-184141211 AGTGTTGTGTGAATCCCAGGAGG + Intronic
985285887 4:188336320-188336342 AGAATGGCGGGAACCCCGGGGGG - Intergenic
985312454 4:188617128-188617150 AGAATGGCATGAACCCCGGGAGG - Intergenic
985325646 4:188765864-188765886 AGAATGGCGTGAACCCCAGAGGG + Intergenic
985340563 4:188948526-188948548 AGAATGGCGGGAACCCCGGGGGG - Intergenic
985356201 4:189122195-189122217 AGAATGGCGGGAACCCCGGGAGG + Intergenic
985648334 5:1095572-1095594 AGAATGGTGTGGGACCCTGAGGG + Intronic
985857039 5:2436630-2436652 AGAATGGCGTGAACCCCAGGGGG - Intergenic
985956594 5:3270428-3270450 AGAATGGCGTGAACCCCCAGGGG - Intergenic
986809272 5:11339025-11339047 AGAATGGCGTGAACCCCAGGGGG - Intronic
987116217 5:14728857-14728879 ATAATGGTGTGCAACCAAGACGG + Intronic
987226388 5:15845880-15845902 AGAATGGCGTGAACCCCAGGAGG + Intronic
987358622 5:17086625-17086647 AGAATGGTGTGAACCCTGGAAGG + Intronic
987554864 5:19433877-19433899 AGAATGGTGTGAACCCGGGAGGG - Intergenic
987620518 5:20334220-20334242 AGAATGGCGTGAACCCCAGGGGG - Intronic
987729371 5:21748948-21748970 AGAATTGCTTAAAACCCAGGGGG - Intergenic
987772618 5:22326322-22326344 AGAATGGCGTGAACCCCGGGGGG - Intronic
987896543 5:23953739-23953761 AGAATGGCATGAACCCCGGGGGG - Intronic
987927247 5:24358604-24358626 AGAATGGCGTGAACCCCGGGGGG - Intergenic
988175142 5:27713359-27713381 AGAATGGCGTAAACCCCGGGGGG + Intergenic
988512641 5:31878647-31878669 AGAATGGCGTGAACCCCGGGGGG - Intronic
988522030 5:31954845-31954867 AGAATCGCTTGAAACCCGGGAGG + Intronic
988864620 5:35321316-35321338 AGAATGGCGTGAACCCCGGGGGG + Intergenic
989169703 5:38462077-38462099 AGAATGGCGTGAACCCCGGGGGG + Intronic
989186982 5:38635526-38635548 AGAATGGCGTGAACCCCGGGGGG - Intergenic
989228104 5:39053801-39053823 AGAATGGCGTGAACCCCAGGGGG + Intronic
989266521 5:39481233-39481255 AGAATGGCGTGAACCCCGGGGGG - Intergenic
989586609 5:43078657-43078679 AGAATGGCGTGAACCCCAGGGGG + Intronic
989587328 5:43085632-43085654 AGAATGGCATGAACCCAAGGAGG + Intronic
989673762 5:43950132-43950154 AGAATGGCGTGAACCCCAGGGGG + Intergenic
989711849 5:44407701-44407723 AGAATCGCTTGAAACCCGGGAGG + Intergenic
990074246 5:51823101-51823123 AGAATGGCGTGAAACCCAGGAGG + Intergenic
990656529 5:57962866-57962888 AGAATGGTGTGAACCCCGGGGGG - Intergenic
990848067 5:60167355-60167377 AGAATGGCGTGAACCCCAGGGGG - Intronic
990850109 5:60193579-60193601 AGAATGGCGTGAACCCCCAGGGG + Intronic
991040925 5:62174737-62174759 AAAAGGGTGTGAAAACCAGGAGG - Intergenic
991944056 5:71882668-71882690 AGAATGGCATGAACCCCGGGGGG + Intergenic
991972910 5:72158095-72158117 AGAATGGCGTGAACCCCGGGGGG - Intronic
992436472 5:76760036-76760058 AGAATGGCGTGAACCCCGCGGGG + Intergenic
992527016 5:77621402-77621424 AGAATGGCGTAAAACCCGGGAGG + Intergenic
992545357 5:77809600-77809622 AGAATGGCGTGAACCCCAGGGGG + Intronic
992629938 5:78670117-78670139 AGAATGGCGTGAACCTCGGGAGG - Intronic
992813326 5:80411054-80411076 AGAATCGCTTGAACCCCAGGAGG - Intronic
992844259 5:80729324-80729346 AGAATGGCGTGAACCCAGGGAGG + Intronic
993033042 5:82726752-82726774 AGAACGGCGTGAACCCCGGGGGG + Intergenic
993780077 5:92055597-92055619 AGAATGGTGGTGAACCCAGGAGG - Intergenic
993887988 5:93439381-93439403 AGAATGGCGTGAACCCCGGGGGG - Intergenic
993975976 5:94481540-94481562 AGTATGAAGAGAAACCCAGGTGG + Intronic
994136553 5:96293845-96293867 AGAATTGCTTAAAACCCAGGAGG - Intergenic
994159627 5:96542219-96542241 AGAATGGCGTGAACCCCGGGGGG + Intronic
994194943 5:96912099-96912121 AGAATGGTGTGAACCCCGGGGGG + Intronic
994660578 5:102649020-102649042 AGCATGGTATGAAACACTGGTGG - Intergenic
994814574 5:104568714-104568736 AGAATGGCGTGAACCCCAGGGGG + Intergenic
994933332 5:106218140-106218162 AGAATGGCGTGAACCCCAGGGGG + Intergenic
995181688 5:109235756-109235778 AGAATGGCGTGAACCTCGGGGGG + Intergenic
995359772 5:111281967-111281989 AGAATGGCGTGAACCCCAGGGGG + Intronic
995440045 5:112181360-112181382 AGAATGGCGTGGAACCCGGGAGG + Intronic
995448851 5:112278337-112278359 AGGATGGCTTAAAACCCAGGAGG - Intronic
995483779 5:112618909-112618931 AGAATGGTGTGAACCCAGGAGGG - Intergenic
995813299 5:116134708-116134730 AGAATGGCGTGAACCCCAGGGGG - Intronic
995880789 5:116842396-116842418 AGAATGGCGTGAACCCCGGAGGG + Intergenic
996064437 5:119066096-119066118 AGAATGGTGTAAAACCCGGGAGG - Intronic
996202568 5:120694593-120694615 AGAATGGCGTGAACCCCAGGGGG + Intergenic
996243371 5:121229424-121229446 AGAATGGCGTGAACCCCAGGGGG - Intergenic
996589318 5:125128178-125128200 AGAAGGGTGAGAAACCCCGATGG - Intergenic
996694143 5:126375456-126375478 AGAATGGTGTGAACCCAGGAAGG - Intronic
996728583 5:126695077-126695099 AGAATTGCTTGAAACCCAGGAGG + Intergenic
996733417 5:126737324-126737346 AGAATGGCGTGAATCCGAGGCGG + Intergenic
996734302 5:126744307-126744329 AGAATGGCGTGAACCCCAGGGGG + Intergenic
996741013 5:126799105-126799127 AGAATGGCGTGAACCCCAGGGGG - Intronic
996774946 5:127122798-127122820 AGAATGGCGTAAAACCCGGGAGG - Intergenic
997082246 5:130753926-130753948 AGAATGGCGTGAACCCCAGGGGG - Intergenic
997116402 5:131130392-131130414 AGAATGGCGTGAACCCCAGGGGG - Intergenic
997501236 5:134375708-134375730 AGAATGGCGTGAACCCCAGGGGG + Intronic
997788237 5:136733492-136733514 AGAATGGCCTGAACCCCAGGGGG - Intergenic
997895460 5:137712067-137712089 AGAATCGCTTGAAACCCAGGAGG + Intronic
997924027 5:138011506-138011528 AGAATGGCGTGAACCCGGGGAGG - Intronic
997930358 5:138067710-138067732 AGAATGGCGTGAACCCCGGGGGG - Intergenic
997931982 5:138080232-138080254 AGAATGGCTTTGAACCCAGGAGG + Intergenic
997934666 5:138099768-138099790 AGAATTGTCTGAAACGCAGGAGG - Intergenic
997948193 5:138221033-138221055 AGAATGGCGTGAACCCCGGGGGG - Intergenic
998097674 5:139405748-139405770 AGAATGGTGTGAACCCCGGTTGG - Intergenic
998631576 5:143904598-143904620 AGAATGGCGTGAACCCCGGGGGG - Intergenic
998777045 5:145615413-145615435 AGAATGGCGTGAACCCCAGGGGG - Intronic
999014299 5:148082696-148082718 AGAATGGCGTGAACCCCAGGGGG - Intronic
999048252 5:148492814-148492836 AGACAGGACTGAAACCCAGGTGG + Intronic
999151078 5:149426686-149426708 AGAATGGTTTGAACCCGGGGAGG - Intergenic
999252791 5:150192560-150192582 ACCATGGGGTGAATCCCAGGAGG - Intronic
1000005224 5:157176905-157176927 AGAATAGCTTTAAACCCAGGAGG - Intronic
1000398307 5:160798838-160798860 AGAATTGCTTGAAACCCGGGAGG - Intronic
1000737215 5:164919778-164919800 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1000760935 5:165223705-165223727 AGAATGGCGTGAACCCTGGGAGG - Intergenic
1000767165 5:165306411-165306433 AGAATCCTGACAAACCCAGGAGG - Intergenic
1000935230 5:167298512-167298534 AGAATGGCGTAAACCCCAGGGGG + Intronic
1001068261 5:168558247-168558269 AGAATGGTGTGAACCCCAGGGGG - Intronic
1001450056 5:171817682-171817704 AGCATAGTGTGAAAACCAGAAGG + Intergenic
1001463867 5:171944484-171944506 AGAATGGCGTGAACCCCGGCAGG + Intronic
1001510906 5:172321138-172321160 AGAATGACGTGAACCCAAGGCGG - Intergenic
1001651385 5:173318535-173318557 GGGATGGTGAGAAATCCAGGTGG + Intronic
1002358324 5:178649010-178649032 AGAATGGTGTGAACCCGAGAGGG + Intergenic
1002404596 5:179020486-179020508 AGAATGGCGTGAACCCCGGGGGG - Intergenic
1002514571 5:179747719-179747741 AGAATGGCGTGAACCCCGGGAGG + Intronic
1002558228 5:180060978-180061000 AGAATGGCGTGAACCCCGGGGGG + Intronic
1003214692 6:4098673-4098695 AGAATGGTGTGAACCCGAGAGGG - Intronic
1003288662 6:4759055-4759077 AGAATGGCGTGAACCCGGGGAGG - Intronic
1003292713 6:4793694-4793716 ATGGTGGTTTGAAACCCAGGTGG + Intronic
1003322855 6:5067622-5067644 GGAAGGGTGTGAACACCAGGAGG + Intergenic
1004142635 6:13034104-13034126 AGAATGGCGTGAACCCCAGGGGG - Intronic
1004161432 6:13217319-13217341 AGAATGGTGCGAGTCCCAGCTGG - Intronic
1004388676 6:15191129-15191151 AGAATGGCGTAAAACCCAGGAGG - Intergenic
1004498020 6:16182831-16182853 AGAATTGTTTGAGCCCCAGGAGG - Intergenic
1004669196 6:17779827-17779849 AGAATGGTGTGAACCCCAGGGGG - Intronic
1005005478 6:21283364-21283386 AGAATGGCGTGAACCCAGGGGGG - Intergenic
1005041666 6:21605938-21605960 ACAATGGTGGTGAACCCAGGAGG + Intergenic
1005108044 6:22246670-22246692 AGATTGCTGTGAAACCCAGCCGG + Intergenic
1005156645 6:22814575-22814597 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1005637660 6:27766899-27766921 AGAATGGCATGAATTCCAGGTGG + Intergenic
1005746331 6:28841549-28841571 AGAATTGCTTGAATCCCAGGAGG + Intergenic
1005897159 6:30188128-30188150 AGAATGGCGTGAACCCCAGGAGG + Intronic
1005964218 6:30715425-30715447 AGAATTGCTTGAAACCCGGGAGG - Intronic
1005983267 6:30853722-30853744 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1006248078 6:32757756-32757778 AGAAAGGTGAGGAACCCAAGGGG - Intronic
1006325528 6:33350981-33351003 AGAATTGCTTGAACCCCAGGAGG - Intergenic
1006597517 6:35204150-35204172 AGAATGGTGTGAACCCCAGGAGG - Intergenic
1006662382 6:35658284-35658306 AGAATGGCGTGAACCCCAGGAGG + Intronic
1006675056 6:35756654-35756676 AGAATGGCGTGAAATCAGGGAGG - Intergenic
1007132948 6:39493871-39493893 AGAAGGCTCTGAAAGCCAGGAGG - Intronic
1007372599 6:41436433-41436455 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1007460440 6:42014276-42014298 AGAATGGCGTGAACCCCGGGGGG + Intronic
1007486460 6:42184176-42184198 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1007579149 6:42945660-42945682 AGAATGGTGTGAACCCAAGGAGG - Intergenic
1007586845 6:42995948-42995970 AGAATGGCGTGAACCCCGGGGGG - Intronic
1007950962 6:45871907-45871929 AGAATGGCCTCGAACCCAGGAGG + Intergenic
1007958838 6:45940786-45940808 AGAACGGTGTTAGGCCCAGGAGG - Intronic
1008009943 6:46455765-46455787 AGAATGGCGTGAACCCAAGGAGG + Intronic
1008197564 6:48543154-48543176 AGAATGGCGTGAACCCCCGGGGG + Intergenic
1008739851 6:54593884-54593906 AGAATGGTGTGAACCTCAGGAGG - Intergenic
1008980172 6:57474262-57474284 AGAATGGCATGAACCCCGGGAGG - Intronic
1008985928 6:57543026-57543048 AGAATGGCGTGAAGCCCAGGGGG - Intronic
1009168274 6:60367193-60367215 AGAATGGCATGAACCCCGGGAGG - Intergenic
1009177789 6:60481844-60481866 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1009699215 6:67154574-67154596 AGAATGGCGTGAACCCGAGAGGG + Intergenic
1009763228 6:68035878-68035900 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1009821445 6:68807325-68807347 AGAATGGCGTGAACCCCGCGGGG - Intronic
1010178669 6:73058321-73058343 AGAATGGCGTGAACCCCGGGGGG + Intronic
1010243765 6:73643247-73643269 GGAATGGTGTGAACCCCAAGGGG - Intronic
1010257250 6:73772414-73772436 AGAATGGCATGAATCCCAGGAGG + Intronic
1010280030 6:74013097-74013119 AGAATGGCGTGAACCCCAGTGGG - Intergenic
1010329061 6:74600642-74600664 AGAATGGCGTGAACCCCGGGGGG - Intergenic
1010347384 6:74827481-74827503 AGAATGGCGTGAACCCGGGGGGG - Intergenic
1010697248 6:78992049-78992071 AGAATGGTGTGAACCCCGGGGGG - Intronic
1010900983 6:81427238-81427260 AAAATGGCGTGAACCCCAAGGGG - Intergenic
1010925386 6:81738610-81738632 AGAATGGAGGAAAACCCAGGTGG - Intronic
1011159349 6:84370679-84370701 AGAATGGGGTGAAATCAGGGAGG + Intergenic
1011486129 6:87844066-87844088 AGAATGGCGTGAACCCGGGGAGG - Intergenic
1011653714 6:89530709-89530731 AGAATGTGGTAAAAGCCAGGAGG + Intronic
1011683464 6:89804945-89804967 AGAATGGTGTGAACCCCGGGAGG + Intronic
1011812253 6:91146197-91146219 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1012012222 6:93803810-93803832 AAAATCGTGTGACACCCAGAAGG - Intergenic
1012026125 6:93994334-93994356 AGAATAGCTTGAACCCCAGGAGG - Intergenic
1012513043 6:100026622-100026644 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1012707528 6:102550833-102550855 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1013082840 6:106827742-106827764 AGAATTGCTTAAAACCCAGGAGG - Intergenic
1013444104 6:110204100-110204122 AGAATGGCGTTGAACCCAGGAGG - Intronic
1013617254 6:111856016-111856038 AGAATGGAGTGAAACTGAGAAGG + Intronic
1013641157 6:112083405-112083427 AAAATGGCGTGAACCCCGGGGGG - Intronic
1013721562 6:113035892-113035914 ATAATGATGAGAAACCTAGGAGG - Intergenic
1014030985 6:116704125-116704147 AGAACTGCTTGAAACCCAGGAGG - Intronic
1014524190 6:122482047-122482069 AGAATGGCGTGAACCCCAGAGGG - Intronic
1014585599 6:123194118-123194140 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1014905769 6:127025250-127025272 AGAATGGTGTGAACCCGGGAGGG - Intergenic
1015025750 6:128530408-128530430 AGAATGGCGTGAACCCCGGGAGG + Intergenic
1015249073 6:131107729-131107751 AGAATAGCTTGAACCCCAGGAGG + Intergenic
1015363885 6:132375512-132375534 AGAATGGCGTGAACCCTGGGAGG - Intronic
1015468343 6:133573687-133573709 AGAATGGCGTGAACCCCGGGGGG + Intergenic
1015667210 6:135645177-135645199 AGAATGGCGTGAACCCCGGGGGG + Intergenic
1015752517 6:136574776-136574798 AGAATGGCATGAACCCCAGGGGG - Intronic
1015785240 6:136916527-136916549 AGGCTTGTGGGAAACCCAGGTGG - Intergenic
1015894349 6:138002414-138002436 AGAATCGCTTGAACCCCAGGAGG - Intergenic
1016022725 6:139252900-139252922 AGAATGGCGTGAACCCCGGGAGG + Intronic
1016153654 6:140776662-140776684 AGAATGGCGTGAAACCTGGGAGG - Intergenic
1016265855 6:142232150-142232172 AGAATTGCTTGAACCCCAGGAGG + Intergenic
1016723829 6:147335709-147335731 AGAATGGCGTGAACCCCAGGGGG + Intronic
1017074301 6:150602990-150603012 AGAATGGCGTGAACCCCGGGGGG + Intronic
1017115912 6:150976109-150976131 AGAATCGCTTGAACCCCAGGAGG + Intronic
1017372466 6:153728774-153728796 AGAATGGCGTGAACCCCGGGGGG - Intergenic
1017457259 6:154612956-154612978 AGAAGGGTGTGGAACCAAGTAGG - Intergenic
1017883787 6:158581664-158581686 AGAATGGTGTGAACCCGGGCGGG + Intronic
1018135544 6:160775182-160775204 AGAATGGCGTGAACCCCGGGGGG + Intergenic
1018235868 6:161723177-161723199 AGAATCGCTTGAACCCCAGGAGG + Intronic
1018332703 6:162748402-162748424 AGAATCGCTTGAACCCCAGGAGG + Intronic
1018412351 6:163563732-163563754 AGAATGTTGTTAACCCCATGGGG - Intronic
1018524190 6:164689646-164689668 AGAATGGTGTGAAACCCGGGAGG - Intergenic
1018959507 6:168437687-168437709 AGAATGGTGTGAACCCGGGAGGG + Intergenic
1019109430 6:169698066-169698088 ACAATGGTGTGAAGCCAAGGAGG + Intronic
1019393016 7:800329-800351 AGAATGGTGTGAACCTTGGGAGG - Intergenic
1019395205 7:814398-814420 AGAATGGCGTGAACCCCCGGGGG + Intergenic
1019515639 7:1438713-1438735 AGAATGGAGGGAAAGCCTGGAGG - Intronic
1019521981 7:1465079-1465101 AGAATCCTTTGAAACCCGGGAGG - Intergenic
1019585586 7:1800659-1800681 AGAATTGTTTGAAACCCGGGAGG + Intergenic
1019672166 7:2286605-2286627 AGAATGGCGTGAACCCCGGGAGG - Intronic
1019686664 7:2385553-2385575 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1019718131 7:2551149-2551171 AGAATCGTTTGAAACCCAGGAGG + Intronic
1019760645 7:2810036-2810058 AGAAAGGGGTCAACCCCAGGAGG + Intronic
1019771257 7:2884965-2884987 AGAATGGCCTGAACCCCGGGGGG - Intergenic
1019988227 7:4673769-4673791 AGAATGGCGTGAACCCTGGGGGG + Intergenic
1020052638 7:5092161-5092183 AGAATGGCGTGAACCCCGGGGGG - Intergenic
1020155701 7:5722477-5722499 AGAATGGCGTGAACCCCGGGGGG - Intronic
1020169719 7:5835771-5835793 AGAATGGTGTGAACCCGGGAGGG - Intergenic
1020228824 7:6301292-6301314 AGAATGGCATGAACCCCAGGAGG + Intergenic
1020238952 7:6377503-6377525 AGGATCGCTTGAAACCCAGGAGG + Intronic
1020321893 7:6944860-6944882 AGAATGGCATGAACCCCGGGAGG + Intergenic
1020401587 7:7784849-7784871 AGAATGGCGTGAACCCCAGGGGG - Intronic
1020585424 7:10059943-10059965 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1020610104 7:10385157-10385179 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1020796015 7:12679598-12679620 AGAATTGCTTGAACCCCAGGAGG - Intergenic
1020930933 7:14393076-14393098 AGAATGGCGTGAACCCCAGGGGG - Intronic
1021650781 7:22830990-22831012 ATCAAGGTGAGAAACCCAGGTGG + Intergenic
1021691008 7:23230697-23230719 AGAATGGTGAGAAAGACAGCTGG - Intergenic
1021692485 7:23243858-23243880 AGAATGGCGTGAACCCTGGGGGG + Intronic
1022004216 7:26252262-26252284 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1022011389 7:26310769-26310791 AGAATGGCGTGAACCCCAGGAGG - Intronic
1022164519 7:27744212-27744234 AGAATGGCGTGAACCCTGGGGGG - Intronic
1022353270 7:29586109-29586131 AGAATCGTTTGAACCCCGGGAGG - Intergenic
1022461835 7:30616394-30616416 AGAAGAGTCTGAAACCCAGATGG - Intronic
1022522528 7:31017361-31017383 AAAATGGAGTGCAGCCCAGGAGG + Intergenic
1022721376 7:32944191-32944213 AGAATGGCGTGAACCCCGGGGGG - Intergenic
1022731503 7:33031008-33031030 AGAATGGCATGAACCCCGGGGGG + Intronic
1022741351 7:33124543-33124565 AGAATGGCGTGAACCCTGGGGGG - Intergenic
1023158004 7:37271026-37271048 AGAATGGCGTGAAACCTAATAGG - Intronic
1023373977 7:39538025-39538047 AGAATGGCGTGAACCCTGGGGGG + Intergenic
1023961260 7:44928183-44928205 AGAATGGTGTGAACCCTGGGTGG + Intergenic
1024139701 7:46449430-46449452 AGAATGGTATGAACCCAGGGAGG - Intergenic
1024357131 7:48425828-48425850 AGAATGGCGTGAACCCCAGGGGG - Intronic
1024480497 7:49856918-49856940 AGAATGGTGTGAACCTGGGGAGG + Intronic
1024545024 7:50510058-50510080 AGAATGGCCTGAACCCCGGGAGG - Intronic
1024746840 7:52417078-52417100 AGAATGGCGTAAAACCTGGGAGG + Intergenic
1025091146 7:56065101-56065123 AGAATGGCGTGAACCCCGGGGGG + Intronic
1025232781 7:57213826-57213848 AGAATGGCGTGAACCCCGGGGGG + Intergenic
1025614997 7:63110632-63110654 AGAATCGCTTGAACCCCAGGGGG + Intergenic
1025630164 7:63264392-63264414 AGAATGGCGTGAACCCCGGGGGG - Intergenic
1025652104 7:63479639-63479661 AGAATGGCGTGAACCCCGGGGGG + Intergenic
1025939032 7:66060312-66060334 AGAATGGCGTGAACCCCGGGGGG + Intergenic
1025961076 7:66222294-66222316 AGAATGGCATGAACCCCGGGAGG + Intronic
1026208205 7:68278066-68278088 AGAATGGTGTAAAACCCGGGAGG - Intergenic
1026329490 7:69339243-69339265 AGAATGGCATGAACCCCGGGGGG + Intergenic
1026431197 7:70348719-70348741 AGAATGGCGTGAACCCCGGGAGG + Intronic
1026914140 7:74109754-74109776 AGAATGGCGTTGAACCCAGGGGG + Intronic
1026926741 7:74199363-74199385 AGAATCGCGTGAACCCGAGGGGG + Intergenic
1027243374 7:76348490-76348512 AGAATGGCGTGAACCCGGGGTGG - Intronic
1027256363 7:76433241-76433263 AGAATCGTTTGAACCCCAGGAGG - Intronic
1027373498 7:77531746-77531768 AGAATGGCATGGAACCCGGGAGG + Intergenic
1027450922 7:78330526-78330548 AGAATGGCGTGAACCCCAGGGGG + Intronic
1027925318 7:84453323-84453345 AGAATGGCGTGAACCCCAGGGGG - Intronic
1028026165 7:85843364-85843386 AGAATGGCGTGAACCCCGGGGGG + Intergenic
1028054986 7:86230132-86230154 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1028195685 7:87904651-87904673 AGAATCACTTGAAACCCAGGAGG + Intronic
1028442446 7:90879905-90879927 TGAGTGGTGTGATACCCAGCTGG + Intronic
1028461300 7:91096151-91096173 AGAACGGTGTGAAGACCAGAAGG - Intronic
1028511643 7:91631748-91631770 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1028552197 7:92081391-92081413 AGAATTGCTGGAAACCCAGGAGG - Intronic
1028565267 7:92223354-92223376 AGAATGGCGTGAACCCCGGGAGG + Intronic
1028701229 7:93783160-93783182 AGAATGGCGTGAACCCCGGGGGG - Intronic
1028713422 7:93936858-93936880 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1029210511 7:98904392-98904414 AGAATGGTGTGAACCCAGGAAGG + Intronic
1029243495 7:99181635-99181657 AGAATCGCTTGAAACCCAGGAGG - Intronic
1029282171 7:99442565-99442587 AGAATGGTGTGAACCCCGGTGGG + Intronic
1029576202 7:101405131-101405153 AGAATGGCGTGAACCCCGGGAGG + Intronic
1029807802 7:103014832-103014854 AGAATGGCATGAACCCCGGGGGG + Intronic
1029842926 7:103385249-103385271 AGAATGGTGTGAACCCGGGGAGG - Intronic
1030103761 7:105969308-105969330 AGAATGGCGTGAACCCCAGGGGG + Intronic
1030182732 7:106727165-106727187 AGAATGGCGTGAACCCCGGAGGG + Intergenic
1030616262 7:111741277-111741299 AGAATGCTATGAAACCAAAGGGG + Intronic
1030941108 7:115650788-115650810 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1031151202 7:118056236-118056258 AGAATGACGTGAACCCCGGGGGG + Intergenic
1031240108 7:119227256-119227278 AGAATTGCTTGAACCCCAGGAGG - Intergenic
1031435397 7:121726830-121726852 AGAATGGCATGAACCCCGGGGGG - Intergenic
1031456062 7:121981051-121981073 AGAATGGCGTGAACCCTGGGGGG + Intronic
1031468268 7:122140394-122140416 AGAATGGCGTGGAACCCGGGAGG + Intronic
1031523833 7:122799512-122799534 AGAATGGCGTGAACCCCGGGAGG + Intronic
1032035591 7:128519079-128519101 AGAATCACTTGAAACCCAGGAGG + Intergenic
1032053322 7:128663535-128663557 AGAATTGCTTGAACCCCAGGAGG - Intergenic
1032225773 7:130030755-130030777 AGAATGGTGTGAACCCCAGGAGG - Intronic
1032254317 7:130284853-130284875 AGAATGGCGTGAACCCCGGGGGG + Intronic
1032417285 7:131745780-131745802 AGAAGGGAGCGAAACCCAGAAGG - Intergenic
1032424520 7:131811324-131811346 AGAATGGCGTGAACCCCGGCGGG + Intergenic
1032604212 7:133331552-133331574 AGAATGGCATGAACCCCAGGGGG - Intronic
1032672677 7:134099617-134099639 AGAATGGCATGAACCCCGGGGGG - Intergenic
1032966209 7:137101664-137101686 AGAATGGCGTGAACCCCGGGGGG - Intergenic
1032970915 7:137163006-137163028 AGAATCGCTTGAACCCCAGGGGG + Intergenic
1033016911 7:137680689-137680711 AGAATTGCTTGAAACCCAGGAGG + Intronic
1033018237 7:137694230-137694252 AGAATGGCATGAACCCCAGGGGG + Intronic
1033051763 7:138010890-138010912 AGAATGGTGTGAACCCTGGGGGG + Intronic
1033246134 7:139717832-139717854 AGAATGGCTTGAAACCTGGGAGG - Intronic
1033333629 7:140434825-140434847 AGAATGGCGTGAACCCCGGGGGG + Intergenic
1033341946 7:140498997-140499019 AGAATGGCGTGAACCCCGGGAGG + Intergenic
1033398632 7:141000289-141000311 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1033473588 7:141669897-141669919 AGAATGGCGTGAACCCCAGGGGG - Intronic
1033767944 7:144515172-144515194 AGAATGATGAGAAAGCCAGGTGG + Intronic
1033920118 7:146380885-146380907 AGAATGGCGTGAACCCCAGGGGG - Intronic
1034153937 7:148938888-148938910 AGAATGGTGTGAACCCGGGAGGG - Intergenic
1034545512 7:151786241-151786263 AAAAAGGGGTGAAGCCCAGGAGG + Intronic
1034628485 7:152512424-152512446 AGAATGGCGTGAAACCCGGGAGG + Intergenic
1034896495 7:154879499-154879521 AGAATGGCGTGAACCCCAGGGGG + Intronic
1035046367 7:155970009-155970031 AGAATCGCTTGAACCCCAGGAGG - Intergenic
1035214498 7:157355247-157355269 AGAACGGCGTGAACCCCGGGAGG - Intronic
1035385458 7:158469350-158469372 AGAATCGTTTGAACCCCAGGAGG + Intronic
1035450121 7:158972614-158972636 AGAATGGTGTGAACCCCGGGGGG - Intergenic
1035548361 8:501114-501136 AGAATGGCGTGAACCCGAGGAGG + Intronic
1036140708 8:6205551-6205573 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1036169814 8:6472553-6472575 AGAATGGCTTGAAACCCAGGAGG - Intronic
1036197246 8:6730417-6730439 AGAATGGCGTGAACCCCAGGGGG - Intronic
1036374283 8:8187224-8187246 AGAATGGCGTTAACCCCAGGAGG - Intergenic
1036537690 8:9666629-9666651 AGAATTGCTTGAAACCCAGGAGG + Intronic
1036567096 8:9946979-9947001 ACAAGGGTGTGAATACCAGGAGG + Intergenic
1036601997 8:10269738-10269760 GGAATGGCGTGAACCCCGGGAGG - Intronic
1036636484 8:10553997-10554019 TGAAAGGTGTGAGACCCAGGCGG - Intronic
1036850871 8:12200513-12200535 AGAATCGCGTGAACCCCGGGGGG - Intergenic
1036872235 8:12442791-12442813 AGAATCGCGTGAACCCCGGGGGG - Intergenic
1036876623 8:12478411-12478433 AGAATGGCGTTAACCCCAGGAGG + Intergenic
1036941324 8:13055341-13055363 AGAATGGCGTGAACCCGAGAGGG + Intergenic
1036973551 8:13382416-13382438 AGAATGGCGTGAACCCCAGGGGG + Intronic
1037610808 8:20474505-20474527 ACAATGGTGTTAAATTCAGGAGG + Intergenic
1038548477 8:28444564-28444586 AGAATGGCGTGAACCCAGGGCGG - Intronic
1038563478 8:28600250-28600272 AGAATCGCTTGAACCCCAGGAGG + Intergenic
1038605904 8:29004207-29004229 AGAATGGTCTGGTACCCTGGAGG + Intronic
1038617067 8:29104831-29104853 AGAATGGCGTGAACCACGGGGGG - Intronic
1038617406 8:29107647-29107669 AGAATGGTGTGAACCCCGGGGGG - Intronic
1038675904 8:29622863-29622885 AGAATGGTGTGAACCCGGGAGGG - Intergenic
1038703586 8:29873851-29873873 AGAATGCTGTGCAACAGAGGAGG - Intergenic
1038768812 8:30456829-30456851 AGAATTGCTTGAAACCCCGGAGG + Intronic
1038803522 8:30770391-30770413 AGAATGGCATGAACCCCGGGAGG + Intergenic
1038864456 8:31424408-31424430 AGAATCGCTTGAACCCCAGGAGG + Intergenic
1039214325 8:35252109-35252131 AGAATGGCGTGAACCCCGTGGGG - Intronic
1039226416 8:35393220-35393242 AGAATGGCATGAACCCCAGGGGG - Intronic
1039254576 8:35705051-35705073 AGAATGGCTTGAAACCCAGGGGG - Intronic
1039472037 8:37819455-37819477 AGAATCGCTTAAAACCCAGGAGG - Intronic
1039699036 8:39943646-39943668 AGAATGGCGTGAACCCCGGGGGG + Intronic
1039746263 8:40430898-40430920 AGTATGGCGTGAACCCCGGGGGG - Intergenic
1039758233 8:40545850-40545872 AGAAAGGTGTGATACCAAGCAGG + Intronic
1039856797 8:41422016-41422038 AGAATGGCGTGAAGCCCAGGGGG + Intergenic
1040003795 8:42600875-42600897 AGAATGGCGTGAACCCAGGGAGG - Intergenic
1040354885 8:46608008-46608030 AGAATGGCGTGAACCCTGGGGGG + Intergenic
1040486536 8:47878192-47878214 ATAATGGCGTGAAACCTGGGAGG - Intronic
1041486573 8:58384125-58384147 AGAATGGCGTGAACCCCGGCGGG - Intergenic
1042069867 8:64920187-64920209 AGAATGGCATGAACCCCGGGGGG - Intergenic
1042256766 8:66812466-66812488 AGAATCGCTTGAAACTCAGGAGG + Intronic
1042460168 8:69056487-69056509 AGAATGGCGTGAACCCTGGGAGG - Intergenic
1042503751 8:69538048-69538070 GGAATGGCGTGAACCCCGGGGGG - Intronic
1042543625 8:69931282-69931304 AGAATGGCATGAACCCCGGGAGG + Intergenic
1042673784 8:71294368-71294390 AGAATGGCGTGAACCCCGGGGGG + Intronic
1042728761 8:71908034-71908056 AGAATGGCATGAACCCCAGGGGG - Intronic
1042865160 8:73350499-73350521 AGAATGGCGTGAACCCCGGGGGG - Intergenic
1042891978 8:73622213-73622235 AGAATGGCGTGAACCCCAGGGGG - Intronic
1042908773 8:73802932-73802954 AGAATGGTGTGAACCCTGGGAGG + Intronic
1043136988 8:76540191-76540213 AGAATGGCGTGAACCCCGGGAGG - Intergenic
1043317305 8:78938547-78938569 AGAATGGTGTGAACCCTGGGAGG - Intergenic
1043338425 8:79206773-79206795 AGAATGGTGTGAACCCCAGGGGG - Intergenic
1043461477 8:80464560-80464582 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1043534057 8:81181184-81181206 ACAAGGGTATGAAAACCAGGAGG + Intergenic
1044366891 8:91358416-91358438 AGAATGGCATGAACCCAAGGAGG - Intronic
1044388661 8:91622323-91622345 AGAATGGTGTGAAACTGAAATGG + Intergenic
1044631437 8:94282832-94282854 TGATTAGTGTAAAACCCAGGAGG - Intergenic
1044678398 8:94752495-94752517 AGAATGGTGTGAACCCAGGAGGG + Intronic
1044992295 8:97806866-97806888 AGAATTGCTTGAACCCCAGGTGG + Intronic
1045127025 8:99103586-99103608 AGAATGGTGTGAACCCGGGGAGG - Intronic
1045148253 8:99372160-99372182 AGAATGGCGTGAACCCCAGGGGG + Intronic
1045501654 8:102748388-102748410 AGAATGGCATGAACCCGAGGGGG + Intergenic
1045765151 8:105658497-105658519 AGAATGGCGTGAACCCCAGGGGG + Intronic
1045792924 8:106007069-106007091 AGAATGGCGTGAAGCCCGAGGGG - Intergenic
1045861119 8:106815940-106815962 AGAATGGCGTGAGCCCCGGGAGG - Intergenic
1046466931 8:114617198-114617220 AGAATGGCGTGAACCCTGGGCGG - Intergenic
1046835974 8:118801545-118801567 AGAATGGCGTGACCCCCGGGAGG + Intergenic
1047001534 8:120578120-120578142 AGAATGGCGTGAACCCCAGGAGG - Intronic
1047166126 8:122440378-122440400 AGAATGGTGTGAACCCAGGGGGG + Intergenic
1047215709 8:122874420-122874442 AGAATTGCTTGAACCCCAGGAGG - Intronic
1047294142 8:123556423-123556445 AGAATGGCTTGAACCCCGGGAGG - Intergenic
1047376302 8:124300713-124300735 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1047401069 8:124547893-124547915 AGAATTGCTTGAATCCCAGGAGG + Intronic
1047632399 8:126722526-126722548 AGAATTGCTTGAACCCCAGGGGG + Intergenic
1047704809 8:127487496-127487518 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1047869270 8:129064570-129064592 AGAATGGTGTGAACCCGGGAGGG + Intergenic
1048112680 8:131485831-131485853 AGTATGGCGTGAAACCGGGGAGG - Intergenic
1048208765 8:132437188-132437210 AGAATGGCGTGAACCCCAGGGGG + Intronic
1048386774 8:133919368-133919390 AGAATTGCTTGAAACCCGGGAGG + Intergenic
1048461791 8:134627171-134627193 AGAATGGTGTAAAATACATGGGG - Intronic
1048560402 8:135529960-135529982 AGAATGGTGTGAAACCCGGGAGG + Intronic
1049023964 8:139975978-139976000 AGAATGGCGTGAACCCCGGGGGG - Intronic
1049233999 8:141499968-141499990 AGAATGGCGTGAAACCCAGGGGG + Intergenic
1049626714 8:143626581-143626603 AGAATGGCGTGAACCCCGGGGGG - Intergenic
1049705085 8:144038036-144038058 AGAATGGCGTGAACCCCGGGGGG + Intronic
1049939997 9:536250-536272 AGAATCACTTGAAACCCAGGAGG + Intronic
1049947324 9:609538-609560 AGAATCATTTGAACCCCAGGAGG + Intronic
1050012438 9:1198887-1198909 GGAATGGGATGAAACCAAGGAGG - Intergenic
1050363329 9:4851968-4851990 AGAATGGCGTTGAACCCGGGAGG - Intronic
1050426991 9:5521797-5521819 ATAATGGTCTGAAACTGAGGAGG - Intronic
1050516646 9:6451564-6451586 AGAATGGTGTGAACCCCGGGGGG - Intronic
1050760098 9:9058536-9058558 AGAATGGCGTGAACCCCAGGGGG - Intronic
1050826288 9:9950633-9950655 AGAATGGCGTGAACCCCAGGGGG + Intronic
1051203471 9:14658558-14658580 AGAATGGCGTGAACCCCAGGGGG - Intronic
1051236065 9:15000481-15000503 ATAATGGTCTGGAACTCAGGAGG - Intergenic
1051409143 9:16770773-16770795 AGAATCGCTTGAACCCCAGGAGG + Intronic
1051720727 9:20034553-20034575 AGAATGGAGTGAACCCGGGGTGG - Intergenic
1051979783 9:22999695-22999717 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1052085706 9:24263263-24263285 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1052309747 9:27052950-27052972 AGAATGGCGTGAACCCCTGGGGG - Intronic
1052762164 9:32603635-32603657 AGAATGGCGTGAACCCCGGGGGG + Intergenic
1052785970 9:32828651-32828673 AGAATGGCGTGAACCCCTGGGGG + Intergenic
1052851106 9:33378936-33378958 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1053177433 9:35937982-35938004 AGAATGGCATGAACCCAAGGAGG + Intergenic
1053212433 9:36242506-36242528 AGAATTGCATGAAACCCAGGAGG - Intronic
1053229186 9:36391700-36391722 AGAATGGCGTGAACCCCAGTGGG - Intronic
1053522822 9:38798140-38798162 AGAATGGCGTGAACCCTGGGAGG + Intergenic
1053571243 9:39310219-39310241 AGAATGGCGTGAACCCCGGGGGG - Intergenic
1053592594 9:39529113-39529135 AGAATGGCGTGAACCCCGGGGGG + Intergenic
1053600756 9:39607041-39607063 AGCAACGTGTGACACCCAGGAGG - Intergenic
1053613125 9:39735179-39735201 AGAATGGTGTGAACCCCGGGAGG + Intergenic
1053673023 9:40388943-40388965 AGAATGGCGTGAACCCAGGGGGG - Intergenic
1053858407 9:42360841-42360863 AGCAAAGTGTGACACCCAGGAGG - Intergenic
1053871168 9:42493123-42493145 AGAATGGTGTGAACCCCGGGAGG + Intergenic
1053922833 9:43015311-43015333 AGAATGGCGTGAACCCAGGGGGG - Intergenic
1054092809 9:60868911-60868933 AGAATTGCGTGAACCCCGGGGGG - Intergenic
1054114281 9:61144823-61144845 AGAATGGCGTGAACCCCGGGGGG - Intergenic
1054125902 9:61308793-61308815 AGAATGGCGTGAACCCCGGGGGG + Intergenic
1054195046 9:62022560-62022582 AGAATGGCGTGAACCCTGGGAGG + Intergenic
1054240391 9:62607223-62607245 AGAATGGTGTGAACCCCGGGAGG - Intergenic
1054252774 9:62735392-62735414 AGCAACGTGTGACACCCAGGAGG + Intergenic
1054554524 9:66641745-66641767 AGAATGGTGTGAACCCCGGGAGG - Intergenic
1054566889 9:66769891-66769913 AGCAACGTGTGACACCCAGGAGG + Intergenic
1054573708 9:66836167-66836189 AGAATGGCGTGAACCCCGGGGGG - Intergenic
1054593472 9:67037699-67037721 AGAATGGCGTGAACCCCGGGGGG + Intergenic
1054643362 9:67566130-67566152 AGAATGGCGTGAACCCTGGGAGG - Intergenic
1054909891 9:70444800-70444822 AGAAAGGTGTGAATGCCAGGAGG + Intergenic
1055060894 9:72067541-72067563 AGAATGGCGTGAAACTCAGGAGG + Intronic
1055093547 9:72387201-72387223 AGAATGGCGTAAAACCCGGGAGG + Intergenic
1055291981 9:74791843-74791865 AGAATGGCGAGAACCCCAGGGGG - Intronic
1055299004 9:74863669-74863691 AGAATGGCGTAAAACCCGGGAGG - Intronic
1055310382 9:74973408-74973430 AGAATCGCTTGAACCCCAGGAGG + Intergenic
1055325443 9:75123331-75123353 AGAATGGCGTGAACCCTTGGGGG + Intronic
1055536679 9:77254030-77254052 AGAATGGTGTGAACCCTGGGGGG - Intronic
1055953253 9:81750600-81750622 AGAATCGTTGGAATCCCAGGAGG - Intergenic
1056107714 9:83363641-83363663 AGAATGGCGTGAACCCCGGGGGG - Intronic
1056144993 9:83720511-83720533 AGAATGGCGTGAACCCCGGGAGG - Intergenic
1056330929 9:85520443-85520465 AGAATGGCGTGAACCCCGGGAGG + Intergenic
1056387199 9:86106863-86106885 AGAATGGTGTGAACCCAGGAGGG + Intergenic
1056405362 9:86268882-86268904 AGAATCGCTTGAACCCCAGGAGG - Intronic
1056498411 9:87184276-87184298 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1056512493 9:87319202-87319224 ACAAGGGTGTGAATGCCAGGAGG + Intergenic
1056741070 9:89255676-89255698 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1056745251 9:89295993-89296015 AGAATGGCGTGAACCCCGGGAGG + Intergenic
1056811584 9:89769268-89769290 AGAATGGCCTGAACCCCCGGGGG - Intergenic
1056960787 9:91121186-91121208 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1057203006 9:93153357-93153379 AGAATGGTGTGAACCTGGGGAGG - Intergenic
1057401255 9:94725790-94725812 AGAATGGCGGGAACCCCGGGGGG - Intergenic
1057501692 9:95601478-95601500 AGAATGGCGTGAACCCCCGGGGG + Intergenic
1057618023 9:96610285-96610307 AGAATGGCGTGAACCCCTGGGGG - Intronic
1057823116 9:98349440-98349462 AGAATCGCTTGCAACCCAGGAGG - Intronic
1057874024 9:98739842-98739864 AGAATGGCGTGAACCCCAGGGGG - Intronic
1058030059 9:100186237-100186259 AGAATTGTTTAAAACCCGGGAGG - Intronic
1058328078 9:103723605-103723627 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1058579500 9:106439672-106439694 AGAATGGCGTTGAACCCGGGAGG + Intergenic
1058782592 9:108353079-108353101 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1058843153 9:108930599-108930621 AGAATGGTGTGAACCCGGGGAGG + Intronic
1059036704 9:110761662-110761684 AGAATGGCGTGAACCCCCGGGGG - Intronic
1059125723 9:111682997-111683019 AGAATGGCGTGAACCCGGGGAGG - Intergenic
1060040250 9:120294267-120294289 AGAATGGTGAGAAACCCCGTGGG + Intergenic
1060079962 9:120634542-120634564 AGAATGGCGTGAACCCCAGGGGG - Intronic
1060084529 9:120684921-120684943 AGAATGGCGTGAACCCTGGGAGG - Intronic
1060366268 9:123018081-123018103 AGAATGGCATGAACCCCGGGGGG - Intronic
1060420487 9:123466085-123466107 AGAATGGTGTGAACCTGAGGTGG - Intronic
1060559820 9:124533737-124533759 AGAATGGCGTGAACCCAGGGAGG - Intronic
1060950295 9:127597619-127597641 AGAATCGCTTGAACCCCAGGAGG - Intergenic
1060988312 9:127833430-127833452 AGAATCGCTTGAACCCCAGGAGG + Intronic
1061131222 9:128709194-128709216 AGAATGGCGGGAACCCCGGGGGG + Intronic
1061199101 9:129126057-129126079 AGAATCCTTTGAAACCCGGGAGG + Intronic
1061315292 9:129791997-129792019 AGAATGGCGTGAACCCCAGGAGG - Intergenic
1061329482 9:129883450-129883472 AGAATTGCTTGAACCCCAGGAGG - Intergenic
1061351933 9:130072306-130072328 AGAATGGCGTGAACCCCAGGGGG - Intronic
1061511594 9:131064572-131064594 AGAATGGCGTGAACCCCGGGGGG + Intronic
1061581896 9:131542958-131542980 AGAATGGCGTGATCCCCTGGGGG - Intergenic
1061978655 9:134087117-134087139 AGAATGTTGGGAAGCCGAGGCGG + Intergenic
1062244348 9:135556811-135556833 AGAATGGCGTGAACCCCGGAAGG - Intergenic
1062376296 9:136263321-136263343 AGAATGGCATGAACCCCGGGGGG - Intergenic
1062420784 9:136481222-136481244 AGAATGGCGTGAACCCCGGGGGG - Intronic
1062505628 9:136874063-136874085 AGAATGGTGTGAACCCTGGGGGG + Intronic
1062563671 9:137153898-137153920 AGAATCGCTTGAATCCCAGGGGG - Intronic
1062648462 9:137563053-137563075 AGGATGGTTTGAGCCCCAGGAGG + Intronic
1203696533 Un_GL000214v1:103599-103621 AGAATTGTGGGATACCCAGTTGG + Intergenic
1203639740 Un_KI270751v1:464-486 AGAATTGTGGGATACCCAGTTGG - Intergenic
1185558078 X:1037079-1037101 AGAATGGTGTGAACCCGGTGGGG - Intergenic
1185703498 X:2249279-2249301 AGAATGGTGTGAACCCAGGAGGG - Intronic
1185959523 X:4533711-4533733 ACAATCGCTTGAAACCCAGGAGG - Intergenic
1186094300 X:6083045-6083067 AGAATGGCGTGAACCCCAGGGGG - Intronic
1186386680 X:9117057-9117079 ACAAGGGTGTGAATGCCAGGAGG - Intronic
1186544589 X:10435590-10435612 ACAAGGGTGTGAACACCAGGAGG + Intergenic
1186836708 X:13445607-13445629 ACAAGGGTGTGAATCCCAGGAGG + Intergenic
1186845075 X:13522574-13522596 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1186904723 X:14099018-14099040 ACAAGGGTGTGAATACCAGGAGG + Intergenic
1187008618 X:15256686-15256708 AGAATGGCGTGAACCCCAGGGGG + Intronic
1187110041 X:16288597-16288619 ACAAGGGTGTGAATACCAGGAGG - Intergenic
1187129369 X:16487501-16487523 AGAATTGCTTGAACCCCAGGAGG - Intergenic
1187137543 X:16562638-16562660 AGAATGGCATGAACCCCGGGGGG - Intergenic
1187258679 X:17665414-17665436 AGAATGGCGTGAACCCCAGGGGG - Intronic
1187529955 X:20087239-20087261 AGATTGGTGGTAAAGCCAGGTGG + Intronic
1187833351 X:23405302-23405324 AGAAAGGGGAGAAACCTAGGAGG + Intergenic
1187860877 X:23681141-23681163 AGAATGGCGTGAACCCTGGGGGG + Intronic
1187994659 X:24913322-24913344 AGAATGGTGTGAATACAAAGGGG + Intronic
1188314522 X:28656935-28656957 AGAATGGCATGAACCCCGGGAGG + Intronic
1188331058 X:28872229-28872251 AGAATGGTCTCAAACCCCTGGGG + Intronic
1188499519 X:30810255-30810277 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1188748474 X:33875837-33875859 AGAATGCTGTGAATCCCAGTGGG + Intergenic
1188917102 X:35925283-35925305 AGAATGGCGTGAACCCCAGGGGG + Intronic
1188948452 X:36337956-36337978 AGAATGGCGTGAACCCCAGGAGG - Intronic
1189296783 X:39924051-39924073 ACAAGGGTGTGAATACCAGGAGG - Intergenic
1189457749 X:41208794-41208816 AGAATGGTGTGAACCCAGGAAGG - Intronic
1190130059 X:47739809-47739831 AGAATGGCATGAACCCAAGGAGG - Intergenic
1190309276 X:49105099-49105121 AGAATCACTTGAAACCCAGGAGG + Intergenic
1190499317 X:51059561-51059583 AGAATGGCGGGAACCCCAGGGGG - Intergenic
1190504095 X:51108810-51108832 AGAATGATGTGAACCCCGGGAGG + Intergenic
1190575778 X:51836657-51836679 AGAATGGCGTAAAACCCGGGAGG - Intronic
1190724630 X:53180815-53180837 AGAATGGGGTGAACCCCCGGGGG - Intergenic
1190725560 X:53188311-53188333 ACAAAGGTGTGAATACCAGGAGG - Intergenic
1190788009 X:53671702-53671724 AGAATGGCGTGAACCCCGGGGGG + Intronic
1190844020 X:54174332-54174354 AAAAGGGTGTGAATACCAGGAGG + Intronic
1192300695 X:69898491-69898513 AGAATCGCTTGAAACCCGGGAGG + Intronic
1192558080 X:72106118-72106140 AGAATGGCGTGAACCCCGGGGGG + Intergenic
1192581506 X:72286537-72286559 AGAATGGCGTGAACCCCGGGGGG - Intronic
1192636139 X:72820605-72820627 AGAATGGCGTGAACCCCAGGGGG - Intronic
1192645575 X:72900209-72900231 AGAATGGCGTGAACCCCAGGGGG + Intronic
1192975194 X:76275867-76275889 AGAATGGCATGAACCCCAGGGGG + Intergenic
1193517456 X:82486017-82486039 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1193519099 X:82507286-82507308 AGAATGGCGTGAACCCCGGGAGG - Intergenic
1193597222 X:83461457-83461479 AGAATGGCGTGAACCCGGGGAGG + Intergenic
1193683186 X:84546822-84546844 AGAATAGTGTGAACCCTGGGGGG + Intergenic
1194042578 X:88960919-88960941 AGAATGGTGTGAACCCCGGAGGG - Intergenic
1194117195 X:89917720-89917742 AGAATTGCTTGAAGCCCAGGAGG - Intergenic
1194351866 X:92830766-92830788 AGAATGGCGTGAACCCCGGGGGG + Intergenic
1194384011 X:93231189-93231211 AGAATTGCTTAAAACCCAGGAGG - Intergenic
1195253726 X:103073848-103073870 AGAATTGCTTGAACCCCAGGAGG - Intergenic
1195265289 X:103173726-103173748 AGAATGGCGTGAACCCAAGGGGG - Intergenic
1195445782 X:104950794-104950816 AGAATGACGTGAACCCCAGGGGG - Intronic
1195615767 X:106910620-106910642 AGAATCGCTTGAACCCCAGGAGG + Intronic
1196352387 X:114746894-114746916 AGAATGGTGTGAACCCGGGAGGG + Intronic
1196633921 X:117978112-117978134 AGAACTGTGTGAAACCTAGTAGG + Intronic
1196695512 X:118607203-118607225 AGAATTGCTTGAACCCCAGGAGG - Intronic
1196911956 X:120492868-120492890 AGAATGGCATGAACCCCGGGGGG - Intergenic
1196926638 X:120640042-120640064 AGAATGGCATGAACCCCGGGGGG + Intergenic
1197902444 X:131388903-131388925 AGAATGGCGTGAACCCTGGGGGG - Intronic
1198219311 X:134585255-134585277 AGAATCGCTTGAACCCCAGGAGG + Intronic
1198538642 X:137612559-137612581 AGAATGGCGTAAAACCTGGGAGG - Intergenic
1198692851 X:139302941-139302963 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1199050987 X:143236513-143236535 AGAATGGCGTGAACCCCGGGGGG + Intergenic
1199110554 X:143928846-143928868 AGAATGGTGTGGAACCCGGGAGG + Intergenic
1199549223 X:149040387-149040409 AGAATCACTTGAAACCCAGGAGG - Intergenic
1199779156 X:151042401-151042423 AGAATGGCGTGAACCCCGGGGGG + Intergenic
1200266469 X:154648779-154648801 AGAATGGCATGAACCCCGGGGGG + Intergenic
1200274678 X:154720535-154720557 AGAATGGCGTGAACCCCGGGGGG + Intronic
1200301658 X:154982356-154982378 AGAATGGCGTGAACCCCGGGGGG + Intronic
1200319016 X:155165503-155165525 AGAATTGCTTGAACCCCAGGAGG - Intergenic
1200469988 Y:3574880-3574902 AGAATTGCTTGAAGCCCAGGAGG - Intergenic
1200887640 Y:8285669-8285691 AGAATGGCGTGAACCCCGGGAGG - Intergenic
1200909816 Y:8521621-8521643 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1201513963 Y:14796503-14796525 AGAATGGCGTGAACCCCAGAGGG + Intronic
1201614568 Y:15882882-15882904 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1201615800 Y:15896893-15896915 AGAATGGCGTGAACCCCAGGGGG - Intergenic
1202053854 Y:20808307-20808329 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1202097119 Y:21263366-21263388 AGAATGGCGTGAACCCCGGGAGG + Intergenic
1202134275 Y:21645603-21645625 AGAATGGCGTGAACCCCAGGGGG + Intergenic
1202584264 Y:26407756-26407778 AGAATGGCGTGAACCCCAGGGGG + Intergenic