ID: 1069534822

View in Genome Browser
Species Human (GRCh38)
Location 10:69245411-69245433
Sequence TTTTTTATTTTCGTAGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319872
Summary {0: 4, 1: 437, 2: 12910, 3: 33020, 4: 273501}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069534822_1069534830 22 Left 1069534822 10:69245411-69245433 CCTGTCTCTACGAAAATAAAAAA 0: 4
1: 437
2: 12910
3: 33020
4: 273501
Right 1069534830 10:69245456-69245478 CCCCTATGGGAGGCTGAGGCAGG No data
1069534822_1069534828 18 Left 1069534822 10:69245411-69245433 CCTGTCTCTACGAAAATAAAAAA 0: 4
1: 437
2: 12910
3: 33020
4: 273501
Right 1069534828 10:69245452-69245474 TGCACCCCTATGGGAGGCTGAGG No data
1069534822_1069534827 12 Left 1069534822 10:69245411-69245433 CCTGTCTCTACGAAAATAAAAAA 0: 4
1: 437
2: 12910
3: 33020
4: 273501
Right 1069534827 10:69245446-69245468 TGATGATGCACCCCTATGGGAGG No data
1069534822_1069534833 25 Left 1069534822 10:69245411-69245433 CCTGTCTCTACGAAAATAAAAAA 0: 4
1: 437
2: 12910
3: 33020
4: 273501
Right 1069534833 10:69245459-69245481 CTATGGGAGGCTGAGGCAGGAGG 0: 129
1: 26737
2: 80175
3: 161578
4: 171077
1069534822_1069534825 8 Left 1069534822 10:69245411-69245433 CCTGTCTCTACGAAAATAAAAAA 0: 4
1: 437
2: 12910
3: 33020
4: 273501
Right 1069534825 10:69245442-69245464 GGTGTGATGATGCACCCCTATGG No data
1069534822_1069534826 9 Left 1069534822 10:69245411-69245433 CCTGTCTCTACGAAAATAAAAAA 0: 4
1: 437
2: 12910
3: 33020
4: 273501
Right 1069534826 10:69245443-69245465 GTGTGATGATGCACCCCTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069534822 Original CRISPR TTTTTTATTTTCGTAGAGAC AGG (reversed) Intronic
Too many off-targets to display for this crispr