ID: 1069534824

View in Genome Browser
Species Human (GRCh38)
Location 10:69245439-69245461
Sequence TAGGGGTGCATCATCACACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069534824_1069534836 22 Left 1069534824 10:69245439-69245461 CCAGGTGTGATGATGCACCCCTA No data
Right 1069534836 10:69245484-69245506 CACTTGAGGCCAGGAGTTCGAGG 0: 155
1: 1929
2: 10413
3: 24367
4: 46924
1069534824_1069534830 -6 Left 1069534824 10:69245439-69245461 CCAGGTGTGATGATGCACCCCTA No data
Right 1069534830 10:69245456-69245478 CCCCTATGGGAGGCTGAGGCAGG No data
1069534824_1069534833 -3 Left 1069534824 10:69245439-69245461 CCAGGTGTGATGATGCACCCCTA No data
Right 1069534833 10:69245459-69245481 CTATGGGAGGCTGAGGCAGGAGG 0: 129
1: 26737
2: 80175
3: 161578
4: 171077
1069534824_1069534834 8 Left 1069534824 10:69245439-69245461 CCAGGTGTGATGATGCACCCCTA No data
Right 1069534834 10:69245470-69245492 TGAGGCAGGAGGATCACTTGAGG 0: 1520
1: 8337
2: 30265
3: 65554
4: 98062
1069534824_1069534835 13 Left 1069534824 10:69245439-69245461 CCAGGTGTGATGATGCACCCCTA No data
Right 1069534835 10:69245475-69245497 CAGGAGGATCACTTGAGGCCAGG 0: 2248
1: 14678
2: 48590
3: 155856
4: 284737
1069534824_1069534828 -10 Left 1069534824 10:69245439-69245461 CCAGGTGTGATGATGCACCCCTA No data
Right 1069534828 10:69245452-69245474 TGCACCCCTATGGGAGGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069534824 Original CRISPR TAGGGGTGCATCATCACACC TGG (reversed) Intronic
No off target data available for this crispr