ID: 1069534830

View in Genome Browser
Species Human (GRCh38)
Location 10:69245456-69245478
Sequence CCCCTATGGGAGGCTGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069534824_1069534830 -6 Left 1069534824 10:69245439-69245461 CCAGGTGTGATGATGCACCCCTA No data
Right 1069534830 10:69245456-69245478 CCCCTATGGGAGGCTGAGGCAGG No data
1069534822_1069534830 22 Left 1069534822 10:69245411-69245433 CCTGTCTCTACGAAAATAAAAAA 0: 4
1: 437
2: 12910
3: 33020
4: 273501
Right 1069534830 10:69245456-69245478 CCCCTATGGGAGGCTGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069534830 Original CRISPR CCCCTATGGGAGGCTGAGGC AGG Intronic
No off target data available for this crispr