ID: 1069537571

View in Genome Browser
Species Human (GRCh38)
Location 10:69266088-69266110
Sequence CACATTTAGCCCTATGTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 124}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069537571_1069537576 21 Left 1069537571 10:69266088-69266110 CCTACCACATAGGGCTAAATGTG 0: 1
1: 0
2: 0
3: 14
4: 124
Right 1069537576 10:69266132-69266154 CATGTAAAGTGCTTCACACGGGG No data
1069537571_1069537575 20 Left 1069537571 10:69266088-69266110 CCTACCACATAGGGCTAAATGTG 0: 1
1: 0
2: 0
3: 14
4: 124
Right 1069537575 10:69266131-69266153 ACATGTAAAGTGCTTCACACGGG No data
1069537571_1069537574 19 Left 1069537571 10:69266088-69266110 CCTACCACATAGGGCTAAATGTG 0: 1
1: 0
2: 0
3: 14
4: 124
Right 1069537574 10:69266130-69266152 CACATGTAAAGTGCTTCACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069537571 Original CRISPR CACATTTAGCCCTATGTGGT AGG (reversed) Intronic
900813965 1:4829026-4829048 CACATTCAGGCCTCTGTGCTAGG - Intergenic
902071250 1:13740703-13740725 CTCATTTAACCCTATGTAGCAGG - Intronic
903003817 1:20285174-20285196 CACAAGTAGTTCTATGTGGTTGG + Intergenic
905528109 1:38654857-38654879 CTCATTTTGCCCTGTGAGGTAGG + Intergenic
906899752 1:49821391-49821413 CTCATTTGACCCTATGTTGTGGG - Intronic
907144406 1:52219401-52219423 CCCTTTTAGCCCAGTGTGGTGGG + Intronic
908096061 1:60740087-60740109 CACATATAGGCATGTGTGGTAGG + Intergenic
908649906 1:66321099-66321121 CACATGTTTCCCTATGTGGGAGG - Intronic
911503524 1:98719175-98719197 CACATTTAGCACTATGAGCTAGG - Intronic
915381750 1:155447872-155447894 CACATTTATCCATATTTGTTTGG + Intronic
917800624 1:178566324-178566346 CTCATACAGCTCTATGTGGTTGG + Intergenic
919979382 1:202632905-202632927 TGCATTTACCCCTCTGTGGTGGG - Intronic
922640680 1:227228096-227228118 CACAGTGAGGCCTATGGGGTGGG + Intronic
1064107551 10:12512860-12512882 CAATATTAGCCCCATGTGGTCGG - Intronic
1065300068 10:24312969-24312991 CTCATTGAGTCCTATGTGCTTGG - Intronic
1067055346 10:43046616-43046638 CACATTGGGCCCGGTGTGGTGGG - Intergenic
1069537571 10:69266088-69266110 CACATTTAGCCCTATGTGGTAGG - Intronic
1069808389 10:71140541-71140563 AAAATTTAGCCAGATGTGGTGGG - Intergenic
1079084291 11:17434081-17434103 CACATTTAGAACTATGTAGTTGG - Intronic
1079373096 11:19868730-19868752 AACTTTTGGCACTATGTGGTTGG + Intronic
1082223508 11:49671884-49671906 TGCATTTATCCCTATGTGGAAGG + Intergenic
1083949581 11:65946723-65946745 CACATCCAGCCCTGTTTGGTTGG + Intronic
1086491666 11:87362387-87362409 AACATTTAGCAGCATGTGGTTGG + Intergenic
1086625551 11:88947378-88947400 TGCATTTATCCCTATGTGGAAGG - Intronic
1089316505 11:117594756-117594778 CATCTTTAGTCCTATGTGGTTGG + Intronic
1089873031 11:121693733-121693755 CACAATTAGCCTGATGTGGTGGG + Intergenic
1094620701 12:32077798-32077820 CACAATCAGCCCAATGTGGTAGG + Intergenic
1094794999 12:33961372-33961394 CACATTTAGCCATAGGTGTTGGG + Intergenic
1094812314 12:34150458-34150480 TTCATTTTGGCCTATGTGGTGGG + Intergenic
1095106793 12:38243618-38243640 CACATTTAGCCATAGGTGTTGGG + Intergenic
1097719389 12:63003447-63003469 CACCTTCAGCCCTCTGTGGCGGG - Intergenic
1097995624 12:65884911-65884933 CACATATAGCACTATGTGCCAGG - Intronic
1099461304 12:82924917-82924939 CACATGAAACCCTATGTGATTGG + Intronic
1100368606 12:93944149-93944171 CACCTTCAGCCCTAGGGGGTTGG + Intergenic
1105052923 12:133070787-133070809 TACACTTAGCCAGATGTGGTGGG - Intergenic
1106292838 13:28381268-28381290 CACAGTTGGCCCTGTGCGGTGGG + Intronic
1106952056 13:34895207-34895229 CACATTTAGTCTTTTCTGGTGGG - Intergenic
1107410406 13:40152835-40152857 CTCATTTGGTCCTAAGTGGTTGG - Intergenic
1109583840 13:64373148-64373170 AACATGTAGCCCAATGTGTTTGG - Intergenic
1111247256 13:85555726-85555748 CATATGTAGCTCTATGTGGTAGG + Intergenic
1112230407 13:97583929-97583951 CATATTTAGCTCTCTCTGGTTGG + Intergenic
1112565608 13:100549187-100549209 CAAAATTAGCCAGATGTGGTGGG + Intronic
1113062932 13:106343331-106343353 CACTTTAAGCCCTGTGCGGTCGG + Intergenic
1119626267 14:76178876-76178898 CATATTTAGGCCCATGTGGAGGG + Intronic
1120686728 14:87546528-87546550 CACATCTTGCCCCATGGGGTGGG + Intergenic
1121891306 14:97593751-97593773 CACATTCTGACCTATGTGGCTGG - Intergenic
1122472026 14:101975221-101975243 TACATTTAACCCTATGGGGTTGG - Intronic
1124494980 15:30180861-30180883 TGCATTTACCCCTCTGTGGTGGG - Intergenic
1124748587 15:32357784-32357806 TGCATTTACCCCTCTGTGGTGGG + Intergenic
1124902572 15:33837940-33837962 CACATTAAACCCTATGTCCTTGG - Exonic
1126187148 15:45841514-45841536 CACACTTAGCCATCTGTGGATGG + Intergenic
1126879608 15:53080499-53080521 TTCATTTTGCCCTTTGTGGTTGG + Intergenic
1131226956 15:90632025-90632047 CACCTGTAGTCCTATGTGCTTGG - Intronic
1134022873 16:10933562-10933584 CACAAACAGCCCAATGTGGTGGG - Intronic
1135170541 16:20179483-20179505 CACATTCTGTCCTATGTGGATGG + Intergenic
1138267332 16:55669053-55669075 CACATATACCCCTATGTGATAGG + Intronic
1140619269 16:76708215-76708237 AACATTTAGCCTTCAGTGGTAGG + Intergenic
1142331320 16:89455760-89455782 TACATTTTGACCTATCTGGTAGG + Intronic
1142335615 16:89488180-89488202 CAAATTTAGCACTATCTTGTGGG + Intronic
1142903705 17:3028680-3028702 CTCATTCAGCCCCCTGTGGTTGG + Intronic
1144453156 17:15397830-15397852 CACATTCAGTTCTCTGTGGTTGG + Intergenic
1147905974 17:43823288-43823310 CACGTTAAGGGCTATGTGGTGGG - Intronic
1148846073 17:50530776-50530798 CCCATTTAGCCGTTTGGGGTGGG - Intronic
1149346685 17:55744743-55744765 CACATTTTGCCTTATGCAGTTGG + Intergenic
1158079991 18:53578564-53578586 CACATTTAGCTTTCTCTGGTTGG + Intergenic
925867644 2:8243196-8243218 CACATCTAGCCCTCTGTTATAGG + Intergenic
930413582 2:51059493-51059515 TACATTTAACACTATGTAGTTGG + Intergenic
930791553 2:55336324-55336346 CACATTTCTCCCTCTTTGGTAGG + Intronic
931625173 2:64250789-64250811 CACATTTAGTCCTGTGAGGGAGG - Intergenic
931989471 2:67775714-67775736 TACATTTTGCCCTAAGTGTTCGG + Intergenic
933006102 2:76997627-76997649 CACATTTAAGAATATGTGGTTGG + Intronic
936869795 2:117122357-117122379 CATATCTAGCCCTGAGTGGTGGG + Intergenic
946801133 2:223417230-223417252 CACATTTGGGCCTATTTAGTTGG + Intergenic
947525308 2:230873748-230873770 CACATTTAGCCCCTTGTCCTGGG + Intronic
948535155 2:238640461-238640483 CACATTTGTCCATCTGTGGTTGG + Intergenic
948615035 2:239193103-239193125 CTCATTTATCCCTGTGTGGGGGG + Intronic
1168818177 20:755140-755162 AACATTTTGGTCTATGTGGTAGG + Intergenic
1173215884 20:41082948-41082970 CATTTTTCCCCCTATGTGGTAGG - Intronic
1173380087 20:42532255-42532277 CACAAACAGCCCTATGGGGTGGG - Intronic
1179314924 21:40235318-40235340 CACATTTTGCCTTATGAAGTAGG + Intronic
1179494581 21:41763787-41763809 CACATTCAGCCCTGGCTGGTCGG - Intronic
1179578716 21:42324188-42324210 CACATTTAGACCTCTGTCTTTGG - Intergenic
1183294760 22:37022944-37022966 CACTTTAAGCCCTTTGTGCTGGG - Intronic
951051722 3:18101354-18101376 CACATCTTGCCTTCTGTGGTTGG + Intronic
954761921 3:52881034-52881056 CAAAATTAGCCAGATGTGGTGGG + Intronic
956601419 3:71026732-71026754 CACATTTTGCCCAGTGTGGCTGG - Intronic
960184882 3:114626145-114626167 AACATTTAGGAATATGTGGTGGG - Intronic
961189024 3:124941815-124941837 CACATTTAAACCTCTGTTGTTGG - Intronic
963479670 3:145855087-145855109 CACATTTTGCCACATGTGGGAGG - Intergenic
966745794 3:183275763-183275785 AACATTTAGCGGGATGTGGTGGG - Intronic
967887590 3:194343745-194343767 AACAATTACCCTTATGTGGTAGG - Intronic
972639968 4:40916552-40916574 CCCATGTAGACTTATGTGGTTGG + Intronic
974408819 4:61511802-61511824 CAGATTTACCCCTCTGTGTTAGG + Intronic
975525854 4:75350209-75350231 TACTTTTAACCCTATGAGGTGGG + Intergenic
977880596 4:102200040-102200062 CACAATGGGCACTATGTGGTTGG - Intergenic
981340892 4:143620157-143620179 CATATTTGGCTCTCTGTGGTTGG - Intronic
985550715 5:532179-532201 CTCAGTTTCCCCTATGTGGTTGG + Intergenic
985550726 5:532239-532261 CTCAGTTTCCCCTATGTGGTTGG + Intergenic
985550749 5:532359-532381 CTCAGTTTCCCCTATGTGGTTGG + Intergenic
987048093 5:14126152-14126174 CTCATTGAGCCCTATGTGCTAGG - Intergenic
990278582 5:54226014-54226036 AGCATTTAGCCCAATGTGATTGG + Intronic
990605657 5:57407263-57407285 CCCATTTAACCCACTGTGGTAGG - Intergenic
993848639 5:92977787-92977809 CATATTTACCCCTAGGTGGAAGG + Intergenic
995095266 5:108228521-108228543 CACATTTTACCCTGTGGGGTAGG - Intronic
999174076 5:149619254-149619276 GAATTTTGGCCCTATGTGGTAGG - Intronic
1003012372 6:2437781-2437803 CATGTTTAACCCTATGGGGTGGG + Intergenic
1008300250 6:49829119-49829141 TACATATAGCCTTTTGTGGTGGG - Intergenic
1009516718 6:64628528-64628550 CACCTGTAGTCCTATGTGGGAGG - Intronic
1010190544 6:73191428-73191450 CACAATCAACCATATGTGGTTGG - Intronic
1012193053 6:96304231-96304253 CCCATTTAGCCAAATGTGCTCGG + Intergenic
1013242173 6:108256508-108256530 CCCATTTAGTCCTAAGAGGTAGG + Intronic
1013599441 6:111690649-111690671 AACATTTATCACTATGTGCTGGG + Intronic
1016971049 6:149764612-149764634 CACATGTAGGCCTAGGTGTTGGG + Intronic
1017246038 6:152226241-152226263 CACATTTCTTCCTATGAGGTAGG - Intronic
1021091814 7:16492553-16492575 CACATTCAGCACAATCTGGTTGG - Intronic
1021414602 7:20367822-20367844 CACAGTTTGGCCTATGTTGTAGG + Intronic
1027264183 7:76484921-76484943 CACATTCAGGCCCATGAGGTTGG + Intronic
1027315552 7:76983035-76983057 CACATTCAGGCCCATGAGGTTGG + Intergenic
1029163082 7:98566851-98566873 TAGATTTAGCCCTAGGTGGAAGG + Intergenic
1032903420 7:136337079-136337101 CAGATTCAGTCCTCTGTGGTAGG + Intergenic
1034381092 7:150692946-150692968 CACATTTAGACCTCTGTATTAGG - Exonic
1038545158 8:28420484-28420506 GACAACTAGACCTATGTGGTTGG - Intronic
1046481599 8:114826012-114826034 AACAATTAGCCAGATGTGGTGGG - Intergenic
1050432044 9:5572024-5572046 CACTTTAAACCCCATGTGGTAGG - Intergenic
1050944159 9:11497467-11497489 CAAATTTAGCTTTATTTGGTTGG + Intergenic
1051605154 9:18911216-18911238 CACTGACAGCCCTATGTGGTGGG + Intergenic
1053168257 9:35859831-35859853 CACGTTCAGCCCTATGAGGAGGG + Intergenic
1053284453 9:36841303-36841325 CTCATTTAAACCTATGGGGTAGG + Intronic
1057975046 9:99596467-99596489 CTCATCAAGCCCTATGTGGAGGG + Intergenic
1059437409 9:114284961-114284983 CACATTCAGCACTATGTGCTGGG + Intronic
1061119269 9:128633245-128633267 CACATGAAGCCCTACGTGGACGG + Exonic
1061465911 9:130779563-130779585 TACATTTAGCCCTTTATGCTTGG + Intronic
1061875611 9:133542130-133542152 CACAGTTAGCCCTCAGTGGCAGG - Intronic
1193181526 X:78463879-78463901 TACATATAGCCCAATGTAGTAGG - Intergenic
1194311284 X:92310538-92310560 AAAAATTAGCCCAATGTGGTGGG - Intronic
1194594281 X:95837750-95837772 CACATTTTCTCCTATTTGGTAGG - Intergenic
1199552730 X:149076339-149076361 AACATTTAGCAGCATGTGGTTGG + Intergenic
1201757443 Y:17501520-17501542 CTCATTTTGGCCTATGTGGTTGG + Intergenic
1201844111 Y:18404462-18404484 CTCATTTTGGCCTATGTGGTTGG - Intergenic